WWW.PDF.KNIGI-X.RU
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - Разные материалы
 

Pages:   || 2 | 3 | 4 | 5 |

«АКТУАЛЬНЫЕ ПРОБЛЕМЫ ИНФЕКЦИОННОЙ ПАТОЛОГИИ И БИОТЕХНОЛОГИИ Материалы VIII-й Международной студенческой научной конференции Том 1 22-23 апреля 2015 года ...»

-- [ Страница 1 ] --

ФГБОУ ВПО «Ульяновская ГСХА им. П.А. Столыпина»

Научно-исследовательский инновационный центр

микробиологии и биотехнологии

Кафедра микробиологии, вирусологии, эпизоотологии

и ветеринарно-санитарной экспертизы

Диаэм

АКТУАЛЬНЫЕ ПРОБЛЕМЫ ИНФЕКЦИОННОЙ

ПАТОЛОГИИ И БИОТЕХНОЛОГИИ

Материалы VIII-й Международной

студенческой научной конференции

Том 1

22-23 апреля 2015 года

Ульяновск – 2015

УДК 631

Актуальные проблемы инфекционной патологии и биотехнологии / Материалы VIII-й Международной студенческой научной конференции / ред.

кол.: Д.А. Васильев [и др.]. – Ульяновск: Ульяновская ГСХА им. П.А. Столыпина, 2015. - Т. 1. – 322 с.

Сборник содержит материалы исследований студентов ВУЗов России и ближнего зарубежья по актуальным проблемам микробиологии, вирусологии, иммунологии, санитарной экспертизы, товароведению, эпизоотологии, эпидемиологии, биотехнологии. Рассмотрены вопросы диагностики, лечения и профилактики инфекционных заболеваний людей и животных. Приводятся современные методы исследования пищевых продуктов и их санитарная оценка, информационно-аналитические исследования по распространению и угрозе возникновения опасных инфекционных заболеваний.

Материалы сборника рекомендованы для студентов биологических, медицинских, ветеринарных специальностей, научных сотрудников, преподавателей и аспирантов.



Редакционная коллегия Дмитрий Аркадьевич Васильев, зав. каф. МВЭиВСЭ (гл. редактор) Сергей Николаевич Золотухин, декан ФВМ (зам. гл. редактора) Юлия Борисовна Васильева, отв. по НИРС каф. МВЭиВСЭ (отв. редактор) Дмитрий Николаевич Хлынов, начальник РИО Валентина Валентиновна Данько, технический редактор (компьютерная верстка) Авторы опубликованных статей несут ответственность за патентную чистоту, достоверность и точность приведенных фактов, цитат, экономико-статистических данных, собственных имен, географических названий и прочих сведений, а также за разглашение данных, не подлежащих открытой публикации.

Статьи приводятся в авторской редакции.

Генеральный спонсор ООО «Диаэм».

ISBN 978-5-905970-51-1 ISBN 978-5-905970-53-5 © ФГБОУ ВПО «Ульяновская ГСХА им. П.А. Столыпина», кафедра МВЭиВСЭ, Ulyanovsk State Agricultural Academy named P.A. Stolypin Research Innovation Center Microbiology and Biotechnology Department of Microbiology, Virology, Epizootiology and veterinarysanitary inspection Dia-m

CURRENT PROBLEMS OF INFECTION

PATHOLOGY AND BIOTECHNOLOGY

Materials VIII-th International Students conference Volume 1 22-23 April 2015

–  –  –

Actual problems of infectious pathology and biotechnology / Materials VIII-th

International Student Conference / Ed. Number.: D.A. Vasiliev [et al.]. - Ulyanovsk:

Ulyanovsk State Agricultural Academy named P.A. Stolypin, 2015. - Vol 1 – 322 p.

The collection contains materials research university students in Russia and abroad on topical problems of microbiology, virology, immunology, sanitary inspection, merchandising, epizootiology, epidemiology, and biotechnology. The problems of diagnosis, treatment and prevention of infectious diseases of humans and animals. Given modern methods of examination of foods and sanitary assessment, information and analytical studies on the spread and threat of infectious diseases.



The Collection is recommended for students of biological, medical and veterinary professions, researchers, professors and graduate students.

Editorial board D. A. Vasiliev, Head.(Ch. Editor) S. N. Zolotukhin, (Dep. Sec. Editor) J.B. Vasilyeva (resp. Editor) D.N. Khlynov, Head of redaction V.V. Dan’ko, Technical Editor General sponsor of “Dia-M” ISBN 978-5-905970-51-1 ISBN 978-5-905970-53-5 © “Ulyanovsk State Agricultural Academy named PA Stolypin “, Department MVE&VSI, 2015 Исследования в области микробиологии и вирусологии УДК 619:612:599.017

ПРОПОЛИС И ЕГО ВЛИЯНИЕ

НА МИКРОБИОЦЕНОЗ КИШЕЧНИКА

Алешин Д.Е., студент 2 курса факультета зоотехнии и биологии

Научный руководитель – Маннапова Р.Т., доктор биологических наук

, профессор

–  –  –

Ключевые слова: прополис, микробиоценоз, кишечная палочка, бифидобактерии, лактобациллы.

Аннотация.

Работа посвящена изучению разных концентраций экстракта прополиса на рост и размножение условно- патогенных кишечных палочек и нормофлоры кишечника – бифидобактерий и лактобацил. Установлено, что оптимальной дозой, способствующей нормальному микробиоценозу в кишечнике животных, является концентрация прополиса Она значительно затормаживает рост условно-патогенных кишечных палочек, создавая условия для активизации бифидо и лактофлоры.

Сегодня развитие животноводства во всем мире связано с внедрением интенсивных технологий выращивания сельскохозяйственных животных, позволяющих получить целевой продукт (молоко, яйца, мясо, шерсть и др.) в ущерб основным физиологическим функциям организма.

Основным методом достижения наибольшей продуктивности животных является: использование стимуляторов роста, кормовых антибиотиков, гормонов, которые способствовали бы наибольшему выходу требуемой продукции без учета их влияния на животных. Такая тактика животноводства приводит к увеличению стрессовых нагрузок на организм и стабильной циркуляции кишечных заболеваний у сельскохозяйственных животных и птиц [1,2].

В последние годы особое внимание исследователей привлекает биологический активный продукт пчеловодства – прополис [1,2].

В этой связи целью исследований явилось - изучить влияние прополиса на показатели естественного микробиоценоза кишечника.

Исследования проводились в лаборатории кафедры микробиологии. Бактерии группы кишечной палочки выделяли из фекалий телят, содержащихся в условиях вивария ТСХА, путем посева на среду Эндо, с последующим выделением чистой бактериальной культуры. Культуры бифидобактерий и лактобацилл

– использовали музейные штаммы. Посев бифидобактерий осуществляли на среду Блаурока в модификации Гончарова Г.И., лактобацилл – на среду лактобакагар.

Актуальные проблемы инфекционной патологии и биотехнологии Для приготовления 20%-го спиртового экстракта прополиса 20 г прополиса измельчали в виде стружки, помещали в 96 градусный этиловый спирт, ежедневно перемешивали в течении 15 дней. Затем полученный экстракт фильтровали и использовали в виде 20%-го спиртового экстракта прополиса. Из него готовили 10, 5,3 и 1%-е настойки прополиса.

Чувствительность эшерихии коли к прополису изучали по выявлению диаметра зоны стерильности. К 1% и 3%-ой концентрации прополиса кишечная палочка не проявила чувствительность. Все чашки Петри с посевами на среду Эндо кишечных палочек при применении данных концентраций имели сплошной рост.

При посеве кишечной палочки на среду Эндо с дисками с 5%-й концентрацией прополиса на долю слабочувствительных кишечных палочек приходилось 57% колоний, чувствительных -18%, хорошо чувствительных -14%, высокочувствительных – 10% колоний.

Самые хорошие результаты получены в отношении кишечной палочки при испытании 10%-й концентрации прополиса. Здесь слабочувствительные колонии составили 7,5%, чувствительные -15,5%, хорошо чувствительные -29,0%, высокочувствительные -48,0%.

К концентрации прополиса 15% процент малочувствительных микробов группы кишечной палочки составил 38,0, чувствительных -22,0%, хорошо чувствительных -10,0%, выскочувствительных -30,0%.

На уровне предыдущей дозы регистрировалась чувствительность микробов кишечной палочки к концентрации прополиса в 20%.

В отношении бифидобактерий и лактобацилл концентрации прополиса в 1 и 3% лишь незначительно активизировали рост нормофлоры в кишечнике.

Концентрации в 15 и 20 %, напротив, подавляли рост этих микроорганизмов.

Прополис в концентрации 5% оказывал позитивное действие на рост нормофлоры, а в концентрации 10% - значительно активизировал рост бифидобактерий и лактобацилл.

Оптимальной дозой, способствующей нормальному микробиоценозу в кишечнике животных, является концентрация прополиса - 10%. Она значительно затормаживает рост условно-патогенных кишечных палочек, создавая условия для активизации бифидо и лактофлоры.

–  –  –

1. Маннапова, Р.Т. Молочная сыворотка в комплексе с пробиотиком и прополисом для повышения продуктивности бычков / Р.Т. Маннапова, И.М.

Файзуллин И.М. // Аграрный вестник Урала.- №8 (87).-2011.-С.-17-20.

Исследования в области микробиологии и вирусологии

2. Маннапова Р.Т. Продукты пчеловодства и пробиотики (Эффективность применения в животноводстве и птицеводстве) / Р.Т. Маннапова, З.А. Залилова З.А., Р.Р. Шайхулов.-.- LAP Lambert. Academic Publishing.-2013.-338 C.

–  –  –

Key words: propolis, E. coli, Lactobacilli, Bifidobacteria.

Summary. The work is devoted to the study of different concentrations of propolis extract on the growth and reproduction of conditionally pathogenic intestinal sticks and normoflore intestinal Bifidobacteria and Lactobacilli-. The optimal dose for normal mikrobiocenozu in the intestines of animals, is a concentration of propolis-10%. It puts much growth of conditionally pathogenic intestinal sticks, creating the conditions for the strengthening of bifido and laktoflory.

УДК 619:618.7

ИССЛЕДОВАНИЯ МИКРОБНОГО ФОНА

ПРИ МАСТИТАХ У КОРОВ НА МЕГАФЕРМЕ

ООО «КРАСНЫЙ ВОСТОК»

Антошкин П.А., студент 4 курса факультета ветеринарной медицины Научный руководитель - Терентьева Н.Ю., кандидат ветеринарных наук, доцент

–  –  –

Ключевые слова: заболевания молочной железы, маститы, условно-патогенная микрофлора, чувствительность к антибиотикам Аннотация. Работа посвящена изучению микробного фона секрета молочной железы коров при серозном и катаральном маститах и определению устойчивости выделенной микрофлоры к антибактериальным препаратам различных групп.

Интенсификация молочного скотоводства поставила перед ветеринарной наукой и практикой проблему борьбы с маститом коров на комплексах и фермах. [2,3,4,5,6,8] Актуальные проблемы инфекционной патологии и биотехнологии Используемые с этой целью традиционные зоогигиенические и акушерские приемы недостаточны, поскольку не учитывают инфекционный аспект болезней вымени у коров, обусловленный патогенной и условно-патогенной микрофлорой, вирулентность которой в условиях концентрации поголовья резко возрастает.[1,7,9,10] Целью исследований было определение видового состава микрофлоры при маститах коров на мегафарме ООО «Красный Восток», также изучения антибиотикорезистентности полученных изолятов.

Материалы и методы. Все работы проводились на кафедре микробиологии вирусологии иммунологии и ветеринарно-санитарной экспертизы.

Использовались стандартные материалы такие, как МПА, 7% соляной агар. Также применялись среды Гисса и тестовая система производства Нии МиВ им Пастера, антибиотикорезистентность проверялась дискодиффузным методом на диски производства НЦиФ Инкубирование проводилось в термостатах температурой 37 °С.

Выделение чистой культуры производилось на чашках Петри рассеиванием по Дригальскому. Контроль проводился микроскопированием полученной культуры, окрашенной по Грамму. После подтверждения монокультуру пересаживали на скошенный полужидкий агар для хранения. Результаты полученные при изучении биохимии сравнивались с определителем бактерий Берджи.

При изучении антибиотикоустоичовости, использовалась суточная культура, выращенная в пробирках на МПБ. Полученная суспензия, объемом 1 мл.

переносилась на МПА для получения газона, выдерживалась 10 минут для осаждения бактерий, излишек МПБ убирался при помощи стерильных пипеток. Далее чашки подсушивались в термостате и на них помещались бумажные диски.

Во всех исследованиях чашки выдерживались при средней температуре 37°С, снятие результатов проводилось каждые 24 часа в течении 3 суток.

В ходе работы использовались пять проб полученных от больных животных с явно выраженными признаками серозного и гнойного мастита.

Результаты исследований. В ходе работы использовались пять проб секрета молочной железы, полученных от больных животных с явно выраженными признаками серозного и гнойного мастита. Были выделены несколько линий культуры видов Staphylococcus aureus и Streptococcus pyogenes.

Были изучены свойства полученных изолятов, полученные данные представлены в таблице 1.

–  –  –

Актуальные проблемы инфекционной патологии и биотехнологии Согласно данным приведённым в таблице, все четыре изолята является Staphylococcus aureus. Свойства изолятов сравнивались с данными из определителя Берджи на основе этого были сделаны выводы о видовой принадлежности выделенных бактерий.

Также в одной из проб. были получены два изолята Streptococcus pyogenes.

Его свойства представлены в таблице 2.

–  –  –

Как и со стафилококками биохимия стрептококков сравнивалась с данными из Берджи и на основе этого делались выводы о видовой принадлежности изолята.

Исследования в области микробиологии и вирусологии У всех выделенных бактерий изучали антибиотикорезистентность. Данное свойство изучалось при помощи диско-дифузного метода. Результаты исследований представлены в таблице 3.

–  –  –

Актуальные проблемы инфекционной патологии и биотехнологии Из полученных данных следует, что наиболее приемлемыми препаратами в плане лечения являются фторхинолы, поскольку все полученные культуры бактерий показали высокую чувствительность ко всем препаратом, представленным в этой группе.

Выводы. Биохимия подтвердила, что возбудителями маститов коров являлись Staphylococcus aureus и Streptococcus pyogenes. Данные возбудители встречаются повсеместно, и заражение произошло, скорее всего, при не соблюдении норм зоогигиены при доении скота или же с загрязнённых поверхностей непосредственно в загоне.

В лечении рекомендуется антибиотики фторхинолового ряда поскольку все возбудители показали высокую чувствительность к группе данных препаратов.

Библиографический список:

1. Акушерско-гинекологическая диспансеризация в хозяйствах Ульяновской области / Н.Ю. Терентьева, И.Р. Юсупов, С.Н. Иванова, М.А. Багманов // Материалы Международной научно-практической конференции «Аграрная наука и образование на современном этапе развития: опыт, проблемы и пути их решения». – Ульяновск : УГСХА, 2009. – С. 121-127.

2. Динамика некоторых биохимических показателей у коров, больных гнойным пододерматитом / Идогов В.В., Ермолаев В.А., Марьин Е.М., Ляшенко П.М., Сапожников А.В.// Материалы Международной научно-практической конференции, посвященной Всемирному году ветеринарии в ознаменование 250-летия профессии ветеринарного врача. – Ульяновск : УГСХА, 2011. - С. 131-132

3. Динамика некоторых иммунологических показателей у коров, больных гнойным пододерматитом / Идогов В.В., Ермолаев В.А., Марьин Е.М., Ляшенко П.М., Сапожников А.В.// Материалы Международной научно-практической конференции, посвященной Всемирному году ветеринарии в ознаменование 250-летия профессии ветеринарного врача. – Ульяновск :

УГСХА, 2011. - С. 129-130.

4. Ляшенко, П.М. Влияние гидрофильных мазей на гемостазиологические показатели плазмы крови у телят с гнойными ранами/ П.М. Ляшенко, В.А. Ермолаев //Материалы VМеждународной научно-практической конференции «Аграрная наука и образование на современном этапе развития: опыт, проблемы и пути их решения» 2013 год: сборник научных трудов. – Ульяновск :

УГСХА им. П.А. Столыпина, 2013. – С. 104-107.

5. Марьин, Е.М. Состояние системы гемостаза, распространенность, этиология и некоторые иммуно-биохимические показатели крови у коров симменИсследования в области микробиологии и вирусологии тальской породы с болезнями копытец /Е.М. Марьин, В.А. Ермолаев, П.М.

Ляшенко// Научный вестник Технологического института - филиала ФГБОУ ВПО «Ульяновская ГСХА им. П.А. Столыпина». - 2013. - № 12. - С. 267-273.

6. Ляшенко, П.М. Морфологические изменения в сосудах при гнойных язвах мякишей у крупного рогатого скота / Ляшенко П.М., Марьин Е.М., Ермолаев В.А.// Материалы Международной научно-практической конференции «Аграрная наука и образование на современном этапе развития: опыт, проблемы и пути их решения». - Ульяновск : УГСХА,2009. - С. 161-164.

7. Микрофлора молока и маточно-цервикального секрета у свиноматок при синдроме метрит-мастит-агалактия / С.Н. Иванова, Н.Ю.Терентьева, М.А.

Багманов, Р.К. Шаев //Ученые записки Казанской государственной академии ветеринарной медицины им. Н.Э. Баумана. - 2010. - Т. 204. - № 1. - С.

111-115.

8. Марьин Е.М. Опыт преподавания ветеринарного предпринимательства в ВУЗЕ / Е.М. Марьин, О.А. Липатова // Материалы научно-методической конференции профессорско-преподавательского состава «Инновационные технологии в высшем профессиональном образовании» - Ульяновск : УГСХА, 2010. - С. 184-186

9. Терентьева, Наталья Юрьевна. Влияние фитопрепаратов на восстановление воспроизводительной функции коров после отела / Н.Ю. Терентьева, М.А.

Багманов // Вестник Ульяновской государственной сельскохозяйственной академии. – 2010.- №1. – С. 82-85.

10. Терентьева, Наталья Юрьевна. Влияние фитопрепаратов на восстановление воспроизводительной функции коров после отела / Н.Ю. Терентьева, М.А.

Багманов // Вестник Ульяновской государственной сельскохозяйственной академии. – 2010.- №1. – С. 82-85.

STUDY OF MICROBIAL BACKGROUND

WITH MASTITIS COWS ON MEGAFERMY LTD.

“THE EAST IS RED” Antoshkin P.A., Terentyeva N.Y.

Keywords: diseases of the breast, mastitis, pathogenic microflora, antibiotic sensitivity This is a study of microbial background mammary secretion of cows with serous and catarrhal mastitis and definition of stability selected microflora to antibiotics of different groups.

Актуальные проблемы инфекционной патологии и биотехнологии УДК 616:619

ИЗУЧЕНИЕ ДИНАМИКИ РЕПЛИКАЦИИ

ШТАММОВ КК-262, ФК-32/135, Ф-32 ВИРУСА

АЧС В КУЛЬТУРЕ КЛЕТОК КОСТНОГО МОЗГА

СВИНЕЙ

Антонова В.В.*, студентка 4 курса факультета ветеринарной медицины Научный руководитель – Бурмакина Г.С.**, кандидат биологических наук

–  –  –

Ключевые слова: Африканская чума свиней, ПЦР, культура клеток костного мозга свиней, репродукция вируса.

Аннотация. Работа посвящена изучению динамики репродукции штаммов вируса АЧС в культурах клеток различного происхождения. Для достижения цели необходимо было изучить динамику репродукции штаммов КК-262, ФК-32/135, Ф-32 вируса АСЧ в культуре клеток костного мозга свиней (ККМС).Результаты проведенных исследований свидетельствовали о некоторых отличиях в динамике накопления различных штаммов вируса АЧС в культуре клеток костного мозга свиней.

Африканская чума свиней (Pestis africana suum — лат.) - инфекционная болезнь домашних и диких свиней, вызывается вирусом семейства Asfarviridae, характеризующаяся лихорадкой, чаще острым течением, цианозом кожи, обширными геморрагиями во внутренних органах и большой летальностью [1].

Независимо от способа распространения поражает 100 % животных всех возрастов. Относится к группе особо опасных болезней животных. Для человека африканская чума свиней опасности не представляет, однако распространение болезни приводит к тяжелым социально-экономическим последствиям для животноводства.

Болезнь была открыта в 1921 году английским исследователем Р. Монтгомери (другое ее название — «Болезнь Монтгомери»). А первые описания АЧС были сделаны незадолго до этого в нескольких областях Южной Африки в период с 1903 по 1905 годы [2].

С 2007 года и по сей день продолжается распространение АЧС среди диких кабанов и домашних свиней на территории европейской части России. Суммарно в России было зафиксировано более 500 вспышек заболевания, экономические потери превысили 30 млрд рублей, уничтожено порядка миллиона животных [3].

Исследования в области микробиологии и вирусологии Работы ученых в последние годы направлены на детальное изучение молекулярных механизмов патогенеза и иммуногенеза болезни, биохимии и репродукции вируса in vivo и in vitro с использованием изолятов вируса АЧС, обладающих различными иммунобиологическими характеристиками [4]. При проведении таких исследований широко используют первичные и перевиваемые культуры клеток различного происхождения (гомологичные и гетерологичные). Для вируса АЧС характерен высокий уровень гетерогенности биологических свойств. Штаммы вируса могут существенно отличаться по степени вирулентности, иммуногенности, антигенным, гемадсорбирующим и культуральным свойствам [5]. К культуральным свойствам вируса можно отнести способность к репродукции на различных культурах клеток, динамику репродукции, наличие или отсутствие цитопатического действия (ЦПД) и т.д.

Целью данной работы является изучение динамики репродукции штаммов вируса АЧС в культурах клеток различного происхождения.

Для достижения цели необходимо было изучить динамику репродукции штаммов КК-262, ФК-32/135, Ф-32 вируса АСЧ в культуре клеток костного мозга свиней (ККМС).

Материалы и методы

Материалы:

Вируссодержащие материалы. В ходе работы были использованы аттенуированные и вирулентные штаммы вирусов африканской чумы свиней (ФК32/135, КК-262, Ф-32), а также изолят Волгоград-2011 вируса АЧС, адаптированный к культуре клеток COS-1. Материалом для выполнения исследований являлась первичная культура клеток костного мозга свиней, инфицированная вирусом АЧС.

Для выделения нуклеиновых кислот т использовали «Набор для выделения нуклеиновых кислот» (ГНУ ВНИИВВиМ Россельхозакадемии) состоящий из:

1. раствор №1;

2. раствор №2;

3. раствор №3.

4. сорбент нуклеиновых кислот (силика);

5. буфер для элюции нуклеиновых кислот.

Для ПЦР в режиме реального времени

1) смесь нуклеозидтрифосфатов dNTP mix 25 mM (Fermentas, Латвия);

2) магний хлористый (25mM) (Fermentas, Латвия);

3) 5х реакционный ОТ-буфер (Интерлабсервис, г. Москва);

4) праймеры для амплификации фрагментов геномов вирусов АЧС и флуоресцентный зонд («Евроген», Москва);

5) Taq-полимераза (5 ед./мкл) («а-фермент», Москва);

Актуальные проблемы инфекционной патологии и биотехнологии

6) деионизированная вода.

Методы:

Выделение ДНК. Выделение суммарной ДНК проводили методом нуклеосорбции с использованием «Набора для выделения нуклеиновых кислот» (ГНУ ВНИИВВиМ Россельхозакадемии), согласно инструкции производителя.

ПЦР в режиме реального времени. Выявление генома вируса АЧС проводили методом ПЦР в режиме реального времени с использованием праймеров и зонда, фланкирующих фрагмент гена, кодирующего белок p72. Амплификацию и детекцию репортерной флуоресценции проводили в термоциклерах «Rotor-Gene 6000» (Corbett Research, Австралия).

Результаты и обсуждение В работе использовали культуру клеток костного мозга свиней, инфицированную штаммами КК-262, ФК-32/135, Ф-32 и изолятом Волгоград-2011, адаптированным к культуре клеток COS-1, с множественностью заражения 0, 1 moi.

Пробы были отобраны на ранние сроки после заражения (2, 4, 6, 8, 24 ч).

Рисунок 1 - Результаты ПЦР в режиме реального времени для выявления ДНК вируса АЧС в образцах ККМС, инфицированной вирусом АЧС штаммами КК-262 (А), ФК-32/135 (Б), Ф-32 (В) и изолятом Волгоград-2011 (Г), через 2, 4, 6, 8, 24 часа после заражения.

Исследования в области микробиологии и вирусологии Рисунок 2 - Графики, отображающие динамику репликации вируса АЧС штаммов КК-262, ФК-32/135, Ф-32 и изолята Волгоград-2011 в ККМС.

ДНК, выделенную методом нуклеосорбции, тестировали в ПЦР в режиме реального времени с использованием праймеров и зонда, фланкирующими фрагмент гена, кодирующего белок p72.Отмечали некоторое различие в динамике накопления ДНК вируса АЧС для разных штаммов (рис 1, 2). Так штамм КК-262 вероятно начинает активно реплицироваться уже через 6 часов после заражения, тогда как штамм ФК-32/135 не реплицируется через даже через 24 часа после заражения. Для штамма Ф-32 и русского изолята Волгоград-2011 увеличения количества вирусной ДНК отмечали только через 24 часа.

Выводы. Таким образом, результаты проведенных исследований свидетельствовали о некоторых отличиях в динамики накопления различных штаммов вируса АЧС в культуре клеток костного мозга свиней.

Библиографический список:

1. Коваленко, Я. Р. Африканская чума свиней / Я. Р. Коваленко, М. А. Сидоров, Л. Г. Бурба. — М., 1972.

2. Бакулов, И. А. Проблемы современной эволюции африканской чумы свиней / И. А. Бакулов, В. В. Макаров // Вестник с.-х. Науки. — 1990.

3. Макаров, В. В. Комментарий к современной ситуации по АЧС / В. В. Макаров // Ветеринарный консультант. — 2007.

4. Прудникова Е.Ю. Адаптация вируса африканской чумы свиней, выделенного в Российской Федерации, к перевиваемым культурам клеток и изучение его биологических свойств. дис.... канд. вет. наук. Покров. – 2013.

Актуальные проблемы инфекционной патологии и биотехнологии

5. African swine fever virus CD2v and C-type lectin gene loci mediate serological specificity / A. Malogolovkin, G. Burmakina, E. R. Tulman, G. Delhon, D. G. Diel, N. Salnikov, G. F. Kutish, D. Kolbasov, D. L. Rock // Journal of General Virology. – 2015. – 96. – Р. 866–873.

–  –  –

Key words: African swine fever, PCR, cell culture bone marrow pigs, reproduction of the virus.

The work is devoted to the study of the dynamics of reproduction of strains of the virus in cell cultures of different origin. To achieve the goal it was necessary to study the dynamics of reproduction strains CC-262, FC-32/135, F-32 virus ASF in the culture of bone marrow cells of pigs (CCMS).The results of these studies showed some differences in the dynamics of accumulation of different strains of the virus in cell culture bone marrow pigs.

УДК 619:612.112.94:616-006.446.2: 599.742.73

ИССЛЕДОВАНИЕ ЛИМФОЦИТОВ

ЗДОРОВЫХ И FELV-ИНФИЦИРОВАННЫХ КОШЕК

МЕТОДОМ АСМ

Артемьев Д.А.,* студент 3 курса факультета ветеринарной медицины, пищевых и биотехнологий, Костишко Б.Б.,** магистрант физико-технического факультета Научные руководители – Красникова Е.С.,* кандидат биологических наук, доцент; Столбовская О.В., ** кандидат биологических наук, доцент

–  –  –

Ключевые слова: кошки, вирусная лейкемия, лимфоцит, атомно-силовая микроскопия, модуль Юнга.

Исследования в области микробиологии и вирусологии Аннотация. Статья посвящена сравнительному анализу морфологических, топографических и упругих свойств лимфоцитов, полученных от здоровых и инфицированных вирусом лейкемии кошек методом атомно-силовой микроскопии (АСМ). Была проведена профилометрия лимфоцитов, изучены карты вертикальных отклонений консоли и карты латеральных сил малых участков. Было выявлено, что упругость лимфоцитов здоровых животных на 8% выше, чем FeLV-инфицированных.

Вирусная лейкемия кошек – хроническое часто встречающееся инфекционное заболевание, в большинстве случаев приводящее к смерти животного.

Размножаясь в селезенке и лимфоузлах, вирус угнетает иммунную систему организма и способствует развитию вторичных бактериальных и вирусных инфекций, угнетает процесс кроветворения [1, 2].

Иммунитет при данном заболевании не изучен, поэтому исследование здоровых и пораженных вирусом лимфоцитов является актуальным в настоящее время вопросом. Лимфоциты, являясь важным звеном иммунной системы, служат мишенью для возбудителя лейкемии [1].

Один из современнейших методов исследования, АСМ, является эффективным методом изучения мембраны и подмембранных структур лимфоцитов.

К таким структурам, в первую очередь, относится цитоскелет. Лимфоциты характеризуются хорошо выраженным цитоскелетом: микротрубочками, промежуточными виментиновыми филаментами и микрофиламентами [3].

Целью настоящего исследования является сравнение структурно-функционального состояния цитоскелета лимфоцитов здоровых и FeLV-инфицированных кошек методом атомно-силовой микроскопии in vitro.

Объектом исследования явились лимфоциты здоровых и FeLV-инфицированных кошек. Лимфоциты выделяли из периферической крови в градиенте плотности фиколл-урографина по стандартной методике. Для оценки локализации клеток на препарате, препараты окрашивали по Романовскому-Гимза. Для исследования поверхности клеток использовали сканирующий зондовый микроскоп Solver Smena A (на базе НИТИ УлГУ, лаборатории сканирующей и зондовой микроскопии, в рамках договора НТС). Сканирование поверхности фиксированных препаратов проводили в полуконтактном режиме на воздухе. Использовались неконтактные кремниевые зонды серии NSG10 (NT-MDT) с жесткостью 5,5 Н/м, резонансной частотой приблизительно 150 кГц, радиусом закругления 10 нм, высота зонда 10-20 мкм.

Световая микроскопия показала, что морфологически лимфоциты больных и здоровых кошек различаются: вирусинфицированные лимфоциты имели эозинофильно окрашенную цитоплазму, неровные контуры, уменьшенное в объеме и смешенное к периферии ядро.

При исследовании препаратов методом АСМ были выявлены некоторые артефакты сканирования, такие как: разрыхление мембраны лимфоцитов; вздуАктуальные проблемы инфекционной патологии и биотехнологии тия на мембране лимфоцитов, высушенных на воздухе; слишком толстый слой клеток на стекле; наличие кристаллов фикола на сканируемой поверхности.

АСМ профилометрия показала, что поверхность здоровых лимфоцитов является более гладкой по сравнению с поверхностью инфицированных. На карте латеральных сил инфицированных лимфоцитов была заметна дополнительная исчерченность поверхности мембраны. Средний объем инфицированных лимфоцитов был на 27,5% меньше объема здоровых, при том, что их диаметр превышал диаметр незараженных лимфоцитов на 18,8% и высота их более чем на 1 мкм была меньше. Анализ модуля Юнга, показал, что упругие свойства мембран инфицированных лимфоцитов на 8% меньше, чем здоровых.

Таким образом, метод АСМ позволил выявить признаки дестабилизация молекулярной ультраструктуры плазмолеммы, что может приводить к потере функциональной активности клетки и изменению жизнедеятельности, а также отражаться на ее функции.

Библиографический список:

1. Чандлер, Э.А. Болезни кошек. АКВАРИУМ ЛТД. 2002.

2. Красникова, Е.С. Оценка диагностической ценности полимеразной цепной реакции и иммунохроматографического анализа при некоторых превалирующих ретровирусных инфекциях кошек / Е.С. Красникова, А.В. Красников, В.А. Агольцов // Аграрный научный журнал. - 2013. - № 2. - С. 23-25.

3. Столбовская, О.В. Исследование вязко-эластических свойств цитоплазматической мембраны лимфоцитов крови человека методом атомно-силовой микроскопии / О.В. Столбовская, Р.М. Хайруллин, Т.К. Куликова, А.В. Снежкина, А.Ф.

Садритдинова // Фундаментальные исследования.- 2013. - № 4-5. - С. 1149-1152.

LYMPHOCYTE STUDY OF HEALTHY

AND FELV-INFECTED CATS

BY AFM METHOD

Artemyev D.A., Kostishko B.B.

Key words: cats, viral leukemia, lymphocytes, atomic force microscopy, the Young’s modulus.

Summary. The article is devoted to the comparative analysis of morphological, topographical and elastic properties of lymphocytes of healthy and FeLV-infected cats by atomic force microscopy (AFM). Profilometry lymphocytes, studying of maps of the vertical deviations of console and maps of lateral forces of small areas were conducted. It was found that the elasticity of lymphocytes of healthy animals is 8% higher than FeLV-infected.

Исследования в области микробиологии и вирусологии УДК 65.09.05

ВЫДЕЛЕНИЕ БАКТЕРИЙ РОДА BACILLUS

ИЗ ОБЪЕКТОВ САНИТАРНОГО НАДЗОРА

Белова К.В., студент 5 курса факультет ветеринарной медицины Научный руководитель - Феоктистова Н.А., кандидат биологических наук, доцент

–  –  –

Ключевые слова: пробы пищевых продуктов, Bacillus cereus, Bacillus subtilis, Bacillus mesentericus, Bacillus megaterium, Bacillus mycoides, токсикоинфекции, бактерии, метод.

Аннотация. В статье описаны результаты исследований по изучению распространенности бактерий рода Bacillus в объектах внешней среды и пищевых продуктах. В результате проведенных исследований нами было выделено 24 культуры, которые мы предварительно отнести к роду Bacillus.

Многочисленными научными работами доказано, что всестороннее изучение бактерий рода Bacillus не должно ограничиваться только Bacillus anthracis.

Контаминация пищевого сырья и продуктов питания бактериями Bacillus cereus, Bacillus subtilis, Bacillus mesentericus, Bacillus megaterium, Bacillus mycoides всех на этапах технологического процесса – это серьезная проблема пищевых производств. Пищевые токсикоинфекции, вызванные вышеназванными бактериями, характеризуются острым течением болезни и могут вызвать летальный исход [1-8]. Широкое распространение бактерий рода Bacillus в пищевых продуктах объясняется тем, что это почвенные сапрофиты, которым характерен процесс спорообразования при неблагоприятных условиях внешней среды [9-14].

Цель исследований – изучение распространенности бактерий рода Bacillus в объектах внешней среды и пищевых продуктах. Для исследований было взято 54 пробы, которые представлены в таблице 1.

Для выделения культуры брали навески весом по 5 г. и добавили их в колбы с МПБ (50 мл). Затем ставили эти колбы в термостат при температуре 37оС на 24 ч. Для выделения «чистой культуры» методом Дригальского из этих проб сделали посев штрихом на среду Донована, посевы культивировали в условиях термостата в течение 24 часов.

С чашек Петри со средой Донована было взято для дальнейших исследований по 1-2 типичных для изучаемых бактерий колонии, которые засевали в пробирки с МПБ, ставили их в термостат на 24 ч. На следующий день из этих пробирок делали повторно посевы на чашку Петри со средой Донована, стаАктуальные проблемы инфекционной патологии и биотехнологии вили в термостат на 24ч. Затем с этих чашек брали по одной колонии и помещали в пробирки с МПА на хранение, которые выдерживали в термостате 24ч.

–  –  –

1. Васильев, Д.А. Разработка параметров постановки реакции нарастания титра фага для индикации бактерий Bacillus mesentericus в объектах санитарного надзора / Д.А. Васильев, С.Н. Золотухин, Н.А. Феоктистова [и др.] // Вестник Ульяновской государственной сельскохозяйственной академии.

- 2012. - № 3. - С. 69-73.

2. Васильев, Д.А. Характеристика биологических свойств бактериофагов вида Bacillus subtilis / Д.А. Васильев Д.А., Н.А. Феоктистова М.А. Юдина [и др.] // Вестник Ульяновской государственной сельскохозяйственной академии.

- 2011. - № 1. - С. 79-83.

3. Васильев, Д.А. Биосенсорная детекция бактерий рода Bacillus в молоке и молочных продуктах для предупреждения их порчи / Д.А. Васильев, С.Н. Золотухин, Н.А. Феоктистова [и др.] // Вестник Ульяновской государственной сельскохозяйственной академии. - 2013. - № 4 (24). - С. 36-43.

4. Калдыркаев, А.И. Разработка системы фаговаров бактерий Bacillus cereus для идентификации и мониторинга данного микроорганизма / А.И. Калдыркаев, Н.А. Феоктистова, А.В. Алешкин // В книге: «Бактериофаги микроорганизмов значимых для животных, растений и человека». - Ульяновск, 2013. - С. 211-225.

5. Райчинец, Ю.А. Методика выделения Paenibacillus larvae / Ю.А. Райчинец, Н.А. Феоктистова, М.А. Лыдина [и др.] // Современные проблемы науки и образования. - 2014. - № 5. - С. 599.

6. Райчинец, Ю.А. Перспективы применения бактериофагов для биоиндикации возбудителя американского гнильца пчел / Ю.А. Райчинец, Е.И. Климушкин, Н.А. Феоктистова, М.А. Лыдина [и др.] // «Экология родного края:

проблемы и пути их решения»: материалы Всероссийской научно-практической конференции с международным участием. – Киров, 2014. - С. 344-345.

7. Садеева, Н.Т. Выделение фагов бактерий вида Bacillus cereus / Н.Т. Садеева, Н.А. Феоктистова, М.А. Юдина [и др.] // В сборнике: Актуальные проблемы инфекционной патологии и биотехнологии: материалы V-й Всероссийской (с международным участием) студенческой научной конференции. – Ульяновск: ГСХА, 2012. - С. 14-17.

8. Феоктистова, Н.А. Перспективы применения бактериофагов рода Bacillus / Н.А. Феоктистова, Д.А. Васильев, М.А. Юдина [и др.] // В сборнике: Настоящее и будущее биотехнологии в решении проблем экологии, медицины, сельского, лесного хозяйства и промышленности Научно-практический сеАктуальные проблемы инфекционной патологии и биотехнологии минар с международным участием. – Ульяновск: УлГУ, 2011. - С. 136-139.

9. Феоктистова, Н.А. Распространение Bacillus cereus и Bacillus mycoides в объектах санитарного надзора / Н.А. Феоктистова, Д.А. Васильев, С.Н. Золотухин [и др.] // Вестник Ульяновской государственной сельскохозяйственной академии. - 2014. - № 1 (25). - С. 68-76.

10. Феоктистова, Н.А. Диагностика картофельной болезни хлеба, вызываемой бактериями видов Bacillus subtilis и Bacillus mesentericus / Н.А. Феоктистова, А.И. Мустафин, Д.А. Васильев [и др.] // Вестник Ульяновской государственной сельскохозяйственной академии. – 2011. – № 3 (15). – С.61-68.

11. Феоктистова, Н.А. Разработка схемы исследования материала с целью выделения и ускоренной идентификации бактерий видов Bacillus cereus и Bacillus subtilis / Н.А. Феоктистова, А.И. Мустафин, А.И. Калдыркаев // Известия Оренбургского государственного аграрного университета. – 2011. - № 4(32).

- С. 288-291.

12. Феоктистова, Н.А. Выделение и изучение биологических свойств бактериофагов рода Proteus, конструирование на их основе биопрепарата и разработка параметров практического применения / автореферат диссертации на соискание ученой степени кандидата биологических наук / Саратовский государственный аграрный университет им. Н.И. Вавилова. Саратов, 2006. – С. 6.

13. Феоктистова, Н.А. Методы выделения бактериофагов рода Bacillus / Н.А. Феоктистова, В.А. Макеев, М.А. Юдина [и др.] // Вестник ветеринарии. - 2011.

- Т. 59. - № 4. - С. 88-89.

ALLOCATION OF BACTERIA OF THE SORT

BACILLUS FROM OBJECTS OF SANITARY

INSPECTION

Belova K.V., Feoktistova N. A.

Keywords: tests of foodstuff, Bacillus cereus, Bacillus subtilis, Bacillus mesentericus, Bacillus megaterium, Bacillus mycoides, toksikoinfektion, bacterium, method.

Summary. In article results of researches on studying of prevalence of bacteria of the sort Bacillus in objects of environment and foodstuff are described. As a result of the conducted researches we allocated 24 cultures which we previously to carry to the sort Bacillus.

–  –  –

УДК 65.09.05

ИЗУЧЕНИЕ ТИНКТОРИАЛЬНЫХ СВОЙСТВ

БАКТЕРИЙ РОДА BACILLUS, ВЫДЕЛЕННЫХ

ИЗ ОБЪЕКТОВ САНИТАРНОГО НАДЗОРА

Белова К.В., студент 5 курса факультет ветеринарной медицины Научный руководитель - Феоктистова Н.А., кандидат биологических наук, доцент

–  –  –

Ключевые слова: пробы пищевых продуктов, Bacillus, окраска, клетка, бактерии, метод.

Аннотация. В статье описаны результаты исследований по изучению тинкториальных свойства четырех выделенных нами культур. Установлено, что все культуры, выделенные нами из проб пищевых продуктов - это грамположительные палочки, что характерно для бактерий рода Bacillus.

Широкое распространение бактерий рода Bacillus в пищевых продуктах объясняется тем, что это почвенные сапрофиты, которым характерен процесс спорообразования при неблагоприятных условиях внешней среды [3-7]. В результате проведенных исследований нами было выделено 24 культуры, которые мы предварительно отнести к роду Bacillus.

Цель наших исследований – изучить тинкториальные свойства четырех выделенных нами культур, которые мы предварительно отнести у роду Bacillus.

Окраска микроорганизма - комплекс методов и приемов, применяемый для изучения морфологических свойств микроорганизмов. В нативном (естественном) состоянии бактерии имеют такой же коэффициент преломления, как и стекло, поэтому они невидимы под микроскопом. Благодаря оптической микроскопии можно изучать их морфологические особенности, что необходимо при проведении бактериологического исследования. Окрашивание бактерий производится как для обнаружения их в исследуемом материале при бактериоскопической диагностике, так и для их идентификации после выделения чистой культуры из исследуемого материала при бактериологическом исследовании [1].

Для приготовления мазка на середину чистого предметного стекла мы наносили небольшую каплю культуры с помощью бактериальной петли. Материал равномерно распределяли на стекле таким образом, чтобы образовался тонкий мазок круглой или овальной формы размером 1-2 см2. Затем препарат высушивали над пламенем горелки. Высушенный мазок подвергали фиксации, вследствие чего он прикрепляется к стеклу (фиксируется), микробы инактивиАктуальные проблемы инфекционной патологии и биотехнологии руются и становятся безопасными, возрастает их восприимчивость к окраске.

Применяют различные способы фиксации. Наиболее простым и самым распространенным способом является фиксация жаром - нагреванием на пламени горелки (препарат несколько раз проводим через наиболее горячую часть пламени горелки). После фиксации производили окраску мазка [2].

–  –  –

Фиксированный мазок окрашивали генцианвиолетом через фильтровальную бумагу (1-2 мин). Сливали краску, аккуратно удаляли фильтровальную бумагу, обрабатывали раствором Люголя (1-2 мин). Раствор сливали, мазок обесцвечивали 96° этиловым спиртом (20-40 секунд - до отхождения фиолетовых струек краски), тщательно промывали стекло дистиллированной водой. Дополнительно окрашивали фуксином (1-2 мин). Промывали дистиллированной водой и высушивали фильтровальной бумагой. Сущность метода состоит в том, что грамположительные бактерии удерживают комплекс краситель - йод и не обесцвечиваются спиртом, грамотрицательные не обладают этим свойством, т. е. обесцвечиваются спиртом (дифференцирующим веществом) и докрашиваются фуксином. В результате грамположительные бактерии приобретают фиолетовый цвет.

Исследования в области микробиологии и вирусологии Нами установлено, что все культуры, выделенные нами из проб пищевых продуктов (рис. 1-4), это грамположительные палочки, что характерно для бактерий рода Bacillus.

–  –  –

1. Никитина, Елена Владимировна. Микробиология: учебник [Электронный ресурс] / Е. В. Никитина, С. Н. Киямова, О. А. Решетник. - СПб.: ГИОРД, 2011.

2. Ткаченко, К.В. Микробиология. Учебное пособие [Электронный ресурс].- Саратов: Научная книга, 2012.

3. Феоктистова, Н.А. Распространение Bacillus cereus и Bacillus mycoides в объектах санитарного надзора / Н.А. Феоктистова, Д.А. Васильев, С.Н. Золотухин [и др.] // Вестник Ульяновской государственной сельскохозяйственной академии. - 2014. - № 1 (25). - С. 68-76.

4. Феоктистова, Н.А. Диагностика картофельной болезни хлеба, вызываемой бактериями видов Bacillus subtilis и Bacillus mesentericus / Н.А. Феоктистова, А.И. Мустафин, Д.А. Васильев [и др.] // Вестник Ульяновской государственной сельскохозяйственной академии. – 2011. – № 3 (15). – С.61-68.

5. Феоктистова, Н.А. Разработка схемы исследования материала с целью выделения и ускоренной идентификации бактерий видов Bacillus cereus и Bacillus subtilis / Н.А. Феоктистова, А.И. Мустафин, А.И. Калдыркаев // Известия Оренбургского государственного аграрного университета. – 2011. - № 4(32). - С. 288-291.

6. Феоктистова, Н.А. Выделение и изучение биологических свойств бактериофагов рода Proteus, конструирование на их основе биопрепарата и разработка параметров практического применения / автореферат диссертации на соискание ученой степени кандидата биологических наук / Саратовский государственный аграрный университет им. Н.И. Вавилова. Саратов, 2006. – С. 6.

7. Феоктистова, Н.А. Методы выделения бактериофагов рода Bacillus / Н.А. Феоктистова, В.А. Макеев, М.А. Юдина [и др.] // Вестник ветеринарии. - 2011. - Т. 59. - № 4. - С. 88-89.

STUDYING OF TINKTORIALNY PROPERTIES OF

THE BACTERIA OF THE SORT BACILLUS ALLOCATED

FROM OBJECTS OF SANITARY INSPECTION

Belova K.V., Feoktistova N.A.

Keywords: tests of foodstuff, Bacillus, coloring, cage, bacteria, method.

Summary. In article results of researches on studying the tinktorialnykh of property of four cultures allocated with us are described. It is established that all cultures allocated with us from tests of foodstuff are grampolozhitelny sticks that is characteristic for sort Bacillus bacteria.

Актуальные проблемы инфекционной патологии и биотехнологии УДК 579.63

МИКРОСКОПИЧЕСКОЕ ИССЛЕДОВАНИЕ СЫРОВ

Бурова Н.С., студент 4 курса факультета ветеринарной медицины Научные руководители – Сульдина Е.В., аспирант;

Васильев Д.А., доктор биологических наук, профессор

–  –  –

Ключевые слова: сыр, бактериология, микроскопия, закваска, патогенные микроорганизмы.

Аннотация. Работа посвящена проведению микроскопического исследования мазков-отпечатков сыров. При проведении исследований визуально определено соотношение молочнокислых стрептококков и палочек в представленных образцах сыра как 2:1. Патогенной микрофлоры в исследуемых сырах найдено не было.

Сыр – это пищевой продукт, вырабатываемый из молока путем коагуляции белков, обработки полученного белкового сгустка и последующего созревания сырной массы. При созревании все составные части сырной массы подвергаются глубоким изменениям, в результате которых в ней накапливаются вкусовые и ароматические вещества, приобретаются свойственные данному виду сыра консистенция и рисунок [1-18].

В основе производства сыра используется ферментативно- микробиологический процесс, протекание которого зависит от физико- химических свойств молока, состава микроорганизмов закваски, их способности развиваться в молоке, в сгустке и сырной массе и условий технологического процесса. При нарушении хотя бы одного компонента этого процесса влечет за собой контаминацию сыров патогенной микрофлорой [2-6].

Целью наших исследований было изучение микрофлоры сыра и роли микроорганизмов в формировании качества сыров.

Исследования проводились на кафедре микробиологии, вирусологии, эпизоотологии и ветеринарно-санитарной экспертизы по общепринятым микробиологическим методам [1].

Результаты исследований. Сыры вырабатывают с использованием чистых и смешанных культур молочнокислых бактерий, пропионовокислых бактерий, микроорганизмов сырой слизи и плесневых грибов. Для обеспечения условий формирования качественного состава микрофлоры сыра, молоко подвергают бродильной и сычужно-бродильной пробам, позволяющим по характеру сгустка судить о присутствии различных групп микроорганизмов в молоке.

Исследования в области микробиологии и вирусологии

–  –  –

Основные биотехнологические превращения происходят при созревании сыров. Созревание - очень сложный многоэтапный процесс, на который оказывают влияние вид использованных культур, качество сырья, соблюдение технологических и санитарно-гигиенических требований при производстве.

Процесс созревания в химическом отношении весьма многообразен. В молодом сыре весь азот входит в состав нерастворимого белка, но по мере созревания сыра белок расщепляется на растворимые пептиды, а далее на свободные аминокислоты (протеолиз), интенсивность этого процесса зависит от протеолитической активности микрофлоры.

В некоторых сырах расщепление белка ограниченно: в твердых сырах в растворимые продукты превращаются всего 25-35 % белка, в мягких практически весь белок. Помимо изменений в белковых компонентах, при созревании происходит гидролиз значительной части жира (Липолиз) при этом основную роль играют липолитические ферменты содержащихся в сыре микроорганизмов.

Актуальные проблемы инфекционной патологии и биотехнологии Некоторые микроорганизмы играют весьма специфическую роль в созревании определенных сортов сыра. Синяя и зеленоватая окраска и неповторимый вкус Рокфора обусловлены ростом в толще сыра плесени Penicillium rogueforti. Иногда при созревании сыров, созревающих под действием плесени, используют бесцветный мутант Pen. rogueforti, чтобы учесть запросы тех потребителей, которым нравится вкус, но неприятна окраска сыра.

Нами исследованы две пробы сыра сортов «Пошехонский» и «Российский» на состав микрофлоры. С каждого образца готовили по три мазка-отпечака с поверхностных и глубоких слоев, фиксировали и окрашивали по Грамму (рис. 1-4).

Библиографический список:

1. Методические указания МУК 4.2.2884-11. Методы микробиологического контроля объектов окружающей среды и пищевых продуктов. М.: ФЦ Роспотребнадзора. 2011.- 24 с.

2. Разработка системы фаготипирования листерий / Е.Н. Ковалева, Д.А. Васильев, Е.В. Сульдина // Инфекция и иммунитет. – 2014. – сентябрь, специальный выпуск – С. 87-88.

3. Выделение бактериофагов бактерий рода Listeria / Д.А. Васильев, Е.Н. Ковалева, Е.В. Сульдина // Инфекция и иммунитет. – 2014. – сентябрь, специальный выпуск – С. 69-70.

4. Основные биологические свойства листериозных бактериофагов / Е.В.

Сульдина, Д.А. Васильев, Е.Н. Ковалева // Материалы VI Международной научно-практической конференции «Аграрная наука и образование на современном этапе развития: опыт, проблемы и пути их решения». Часть III / Ульяновск, ГСХА им. П.А.Столыпина. - 2015. – С.125-127.

5. Фаготипирование листерий / Е.В. Сульдина, Е.Н. Ковалева, Д.А. Васильев // Материалы Всероссийского симпозиума с международным участием «Современные проблемы физиологии, экологии и биотехнологии микроорганизмов». Москва, МГУ имени М.В. Ломоносова. Биологический факультет.

– М.: МАКС Пресс. - 2014. – С.223

6. Васильев, Д.А. Разработка параметров количественного определения бактерий видов Listeria monocytogenes и Listeria ivanovii на основе мультиплексной пцр в режиме «реального времени» / Д.А. Васильев, Е.Н. Ковалева, Е.В. Сульдина, А.В. Мастиленко // Материалы Международной научно-практической конференции, посвященной 55-летию ВНИИВВиМ «Актуальные вопросы контроля инфекционных болезней животных». Покров. - 2014. - С. 91-96.

7. Золотухин С.Н. Изучение чувствительности Е.coli к колифагам / С.Н. Золотухин, Н.И. Молофеева, Д.А. Васильев // Вестник Ульяновской государственИсследования в области микробиологии и вирусологии ной сельскохозяйственной академии. Ульяновск. - 2001. - № 11. - С. 59.

8. Золотухин С.Н. Чувствительность патогенных энтеробактерий, выделенных при диареях молодняка животных к антибиотикам и специфическим бактериофагам / С.Н. Золотухин, А.С. Мелехин, Д.А. Васильев, Л.С. Каврук, Н.И.

Молофеева, Л.П. Пульчеровская, Б.М. Коритняк, Е.А. Бульканова // Профилактика, диагностика и лечение инфекционных болезней, общих для людей и животных. Ульяновск. - 2006. - С. 233-236.

9. Золотухин С.Н. Выделение и селекция клонов бактериофагов патогенных энтеробактерий / С.Н. Золотухин, Д.А. Васильев, Л.С. Кавруг, Н.И. Молофеева, Л.П. Пульчеровская, Б.М. Коритняк, Е.А. Бульканова, Н.А. Феоктистова, Е.Н. Пожарникова, А.С. Мелехин, Н.Г. Барт, Н.П. Катмакова // Профилактика, диагностика и лечение инфекционных болезней, общих для людей и животных. Ульяновск. - 2006. - С. 227-230.

10. Золотухин С.Н. Штаммы бактериофагов малоизученных патогенных энтеробактерий и их практическое применение / С.Н. Золотухин, Д.А. Васильев, Л.С. Каврук, Л.П. Пульчеровская, Н.И. Молофеева, Б.М. Коритняк, А.Ю. Кузнецов, Е.А. Бульканова, Е.Н. Пожарникова, Н.А. Феоктистова, А.С. Мелехин, С.В. Ленев // В сборнике: Научные разработки и научно-консультационные услуги Ульяновской ГСХА. Информационно-справочный указатель. Ульяновск. - 2006. - С. 45-49.

11. Потатуркина-Нестерова Н.И. Атомно-силовая микроскопия как метод исследования в микробиологии / Н.И. Потатуркина-Нестерова, И.С. Немова, А.В.

Даньшина // Современные проблемы науки и образования. - 2012. - № 3.

- С. 316.

12. Л.Л. Елистратова Современное состояние проблемы демодекоза / Л.Л.

Елистратова, Н.И. Потатуркина-Нестерова, А.С. Нестеров // Фундаментальные исследования. - 2011. - № 9-1. - С. 67-69.

13. Потатуркина-Нестерова Н.И. Изменение вирулентных свойств урогенитальных энтерококков в условиях межмикробных взаимоотношений / Н.И.

Потатуркина-Нестерова, И.С. Немова, М.Н. Артамонова, Е.Б. Хромова, О.Е.

Хохлова, Н.В. Трофимова, О.В. Теплякова, И.А. Кочергина // Современные проблемы науки и образования. - 2013. - № 1. - С. 8.

14. Белозерова Е.А. Влияние хронического поступления солей меди, цинка и свинца на микробиологический баланс толстой кишки в условиях эксперимента / Е.А. Белозерова, Н.И. Потатуркина-Нестерова, Е.С. Климов. - Токсикологический вестник. - 2007. - № 4. - С. 26-30.

15. Сульдина Е.В. Применение метода молекулярно-генетического анализа для видовой идентификации мяса / Е.В. Сульдина, О.Л. Колбасова, С.В. Мерчина // Актуальные проблемы инфекционной патологии и биотехнологии МатеАктуальные проблемы инфекционной патологии и биотехнологии риалы V-й Всероссийской (с международным участием) студенческой научной конференции. Ульяновск. - 2012. - С. 227-231.

16. Сульдина Е.В. Применение метода Real-time PCR для видовой идентификации мясного сырья в мелкоизмельченных полуфабрикатах и готовых мясных продуктах / Е.В. Сульдина, О.Л. Колбасова, С.В. Мерчина // Актуальные проблемы инфекционной патологии и биотехнологии Материалы V-й Всероссийской (с международным участием) студенческой научной конференции. Ульяновск. - 2012. - С. 236-240.

17. Сульдина Е.В. Определение видовой принадлежности мясного сырья в мелкоизмельченных полуфабрикатах и готовых мясных продуктах методом ДНК-диагностики / Е.В. Сульдина, О.Л. Колбасова, С.В. Мерчина // Актуальные проблемы инфекционной патологии и биотехнологии Материалы V-й Всероссийской (с международным участием) студенческой научной конференции. Ульяновск. - 2012. - С. 231-235.

18. Сульдина Е.В. Определение видовой принадлежности мяса методом полимеразной цепной реакции в режиме «Реального» времени / Е.В. Сульдина, О.Л. Колбасова, С.В. Мерчина // Актуальные проблемы инфекционной патологии и биотехнологии Материалы V-й Всероссийской (с международным участием) студенческой научной конференции. Ульяновск. - 2012. - С. 241MICROSCOPIC EXAMINATION OF CHEESE Burova N.S., Suldina E.V.

Keywords: cheese, bacteriology, microscopy, yeast, pathogenic microorganisms.

Summary. The work is dedicated to conducting microscopic examination of smears cheese. In conducting research visually determined the ratio of lactic streptococci and sticks in the submitted samples of cheese as 2: 1. Pathogenic organisms in the test cheeses were found.

–  –  –

УДК 616.619

БИОЛОГИЧЕСКИЕ СВОЙСТВА

И УСТОЙЧИВОСТЬ К АНТИМИКРОБНЫМ

ПРЕПАРАТАМ FLAVOBACTERIUM

PSYCHROPHILUM

Воротников А.П., Кафидова А.В., студенты 3 курса факультета ветеринарной медицины Научные руководители - Молофеева Н.И., кандидат биологических наук, доцент, Васильев Д.А., доктор биологических наук, профессор

–  –  –

Ключевые слова: флавобактерии, аэробы, антибиотикоустойчивость.

Аннотация. Среди многочисленных бактерий, заражающих рыб, Flavobacterium psychrophilum за последние годы вызывает все больший интерес. Этот микроорганизм встречается во всех водных экосистемах мира, чаще всего в пресной воде.

F. psychrophilum – грамотрицательные палочковидные аэробы 2-5 мкм в длину и 0,3-0,5 мкм в диаметре, с округлыми или заостренными концами. Температурный оптимум находится в пределах 4-12 °С. В лабораторных условиях выращивается при комнатной температуре. На мясо-пептонном агаре дает мажущие колонии R-формы желтого цвета (от кремовых до оранжевых) [1,2].

Данный возбудитель вызывает холодноводную бактериальную болезнь рыб (bacterial coldwater disease (BCWD)), которую впервые описал Борг в 1948 году. В Европе данное заболевание называют «обжаренный синдром радужной форели» (rainbow trout fry syndrome (RTFS)). Это заболевание встречается во всем мире, преимущественно у лососевых при искусственном выращивании.

Заболевание может распространяться как горизонтальным путем, так и вертикальным. Вспышки BCWD возникают, когда температура воды колеблется от 4° до 20°C. Летальность может быть, как очень низкой (1%) и непрерывной, так и достигать 75% при вспышках заболевания. Самый высокий показатель смертности составил 90% у радужной форели, 85% у семги.

Первичным очагом инфекции являются жабры и плавники, на которых образуются некротические проявления, также отмечается некроз тканей в области рта. Зараженные рыбы становиться вялыми, брюшная полость часто заполнена жидкостью, наблюдается пучеглазие. В связи с тяжелой анемией жабры, почки Актуальные проблемы инфекционной патологии и биотехнологии и селезенка часто бледные. При хронической форме инфицируется мозг и/или отдельные части позвоночника. F. psychrophilum может вызвать размягчение оболочек икры.

Вирулентные формы патогенных бактерий F. psychrophilum вызывают эпизоотии и массовую гибель рыб, при неблагоприятных или стрессовых условиях, а также способствуют повышению восприимчивости гидробионтов к инфекциям и усиливают приспособляемость бактерий.

При изучении биохимических свойств использовали сахара: глюкозу, маннозу, раффинозу, лактозу, дульцит и другие. Результаты исследования биохимических свойств штаммов F. psychrophilum представлены в таблице 1.

–  –  –

Одним из биохимических свойств F. psychrophilum является способность утилизировать мочевину.

При изучении антибиотикоустоичовости, использовалась суточная культура, выращенная в пробирках на МПБ. Полученная суспензия, объемом 1 мл переносилась на МПА для получения газона, выдерживалась 10 минут для осаждения бактерий, излишек МПБ убирался при помощи стерильных пипеток. Далее чашки подсушивались в термостате и на них помещались бумажные диски.

Во всех исследованиях чашки выдерживались при средней температуре 230С, снятие результатов проводилось каждые 24 часа в течении 3 суток.

–  –  –

Актуальные проблемы инфекционной патологии и биотехнологии В процессе исследований было выяснено, что изучаемые штаммы F.

psychrophilum не чувствительны к антимикробным препаратам группы нитрофуранов и В-лактамных пенициллинам (за исключением карбеницилина), но высоко чувствительны к фторхинолам. Результаты исследования представлены в таблице 2.

Библиографический список:

1. Парамонова, Н.А. Роль бактерий Flavobacterium psychrophilum в патогенезе рыб / Н.А. Парамонова, Д.А. Викторов, Д.А. Васильев, С.Н. Золотухин // Биотехнология: реальность и перспективы в сельском хозяйстве: Материалы Международной научно-практической конференции, Саратов, ФГБОУ ВПО «Саратовский ГАУ», 28-29 января 2013. – Саратов: Издательство «КУБиК», 2013. – С. 93-95.

2. Парамонова, Н.А. Об актуальности и практической значимости изучения Flavobacterium psychrophilum / Н.А. Парамонова, Д.А. Викторов, Д.А. Васильев // Аграрная наука и образование на современном этапе развития: опыт, проблемы и пути их решения: Материалы IV международной научно-практической конференции, Ульяновск, 22-24 ноября 2012. – Т. 1. – С. 303-306.

3. Викторов Д.А. Результаты изучения биохимических свойств Flavobacterium psychrophilum / Д.А. Викторов, А.П. Воротников, Н.А. Парамонова, Д.А. Васильев // Международный научно-исследовательский журнал = Research journal of international studies. – Екатеринбург: «Индивидуальный предприниматель Соколова Марина Владимировна», 2014. – № 2-1 (21). – С.

53-54.

4. Васильева Ю.Б. Изучение чувствительности и диагностической эффективности тeст-cистемы индикации и идентификации бактерий B. bronchiseptica / Ю.Б. Васильева, А.В. Мастиленко, Д.А. Васильев, Р.Р. Бадаев, С.В. Мерчина, И.Г. Швиденко, А.С. Скорик // Современные проблемы науки и образования. - 2014. - № 5. - С. 596. Золотухин С.Н. Изучение чувствительности Е.coli к колифагам / С.Н. Золотухин, Н.И. Молофеева, Д.А. Васильев // Вестник Ульяновской государственной сельскохозяйственной академии. Ульяновск.

- 2001. - № 11. - С. 59.

5. Золотухин С.Н. Чувствительность патогенных энтеробактерий, выделенных при диареях молодняка животных к антибиотикам и специфическим бактериофагам / С.Н. Золотухин, А.С. Мелехин, Д.А. Васильев, Л.С. Каврук, Н.И. Молофеева, Л.П. Пульчеровская, Б.М. Коритняк, Е.А. Бульканова // В сборнике: Профилактика, диагностика и лечение инфекционных болезней, общих для людей и животных. Ульяновск. - 2006. - С. 233-236.

Исследования в области микробиологии и вирусологии

6. Золотухин С.Н. Выделение и селекция клонов бактериофагов патогенных энтеробактерий / С.Н. Золотухин, Д.А. Васильев, Л.С. Кавруг, Н.И. Молофеева, Л.П. Пульчеровская, Б.М. Коритняк, Е.А. Бульканова, Н.А. Феоктистова, Е.Н. Пожарникова, А.С. Мелехин, Н.Г. Барт, Н.П. Катмакова / Профилактика, диагностика и лечение инфекционных болезней, общих для людей и животных. Ульяновск. - 2006. - С. 227-230.

7. Курьянова Н.Х. Проблемы биологической диагностики орнитобактериоза / Н.Х. Курьянова, Н.И. Молофеева, Д.А. Васильев // Научный вестник Московского государственного горного университета. Москва. - 2009. - С. 170.

8. Золотухин С.Н. Штаммы бактериофагов малоизученных патогенных энтеробактерий и их практическое применение / С.Н. Золотухин, Д.А. Васильев, Л.С. Каврук, Л.П. Пульчеровская, Н.И. Молофеева, Б.М. Коритняк, А.Ю. Кузнецов, Е.А.

Бульканова, Е.Н. Пожарникова, Н.А. Феоктистова, А.С. Мелехин, С.В. Ленев // В сборнике: Научные разработки и научно-консультационные услуги Ульяновской ГСХА. Информационно-справочный указатель. Ульяновск. - 2006. - С. 45-49.

9. Потатуркина-Нестерова Н.И. Атомно-силовая микроскопия как метод исследования в микробиологии / Н.И. Потатуркина-Нестерова, И.С. Немова, А.В.

Даньшина // Современные проблемы науки и образования. - 2012. - № 3.

- С. 316.

10. Елистратова Л.Л. Современное состояние проблемы демодекоза / Л.Л.

Елистратова, Н.И. Потатуркина-Нестерова, А.С. Нестеров // Фундаментальные исследования. - 2011. - № 9-1. - С. 67-69.

11. Потатуркина-Нестерова Н.И. Изменение вирулентных свойств урогенитальных энтерококков в условиях межмикробных взаимоотношений / Н.И.

Потатуркина-Нестерова, И.С. Немова, М.Н. Артамонова, Е.Б. Хромова, О.Е.

Хохлова, Н.В. Трофимова, О.В. Теплякова, И.А. Кочергина // Современные проблемы науки и образования. - 2013. - № 1. - С. 8.

12. Белозерова Е.А. Влияние хронического поступления солей меди, цинка и свинца на микробиологический баланс толстой кишки в условиях эксперимента / Е.А. Белозерова, Н.И. Потатуркина-Нестерова, Е.С. Климов. -Токсикологический вестник. - 2007. - № 4. - С. 26-30.

13. Яцишина С.Б. Применение мультиплексной ПЦР для идентификации вирулентных форм возбудителя сибирской язвы / С.Б. Яцишина, И.Л. Обухов, Л.С. Саленко, Б.И. Шморгун и др. // Сб. тезисов Генодиагностика инфекционных заболеваний. Всеросс. науч.-практич. Конференция. – 2002.

14. Калдыркаев А.И. Разработка системы фаговаров Bacillus cereus / А.И. Калдыркаев, Н.А. Феоктистова, Д.А. Васильев, А.В. Алешкин, С.В. Мерчина // Материалы V Международной научно-практической конференции. Ульяновск, ГСХА им. П.А. Столыпина. -. 2013. - С. 178-185.

Актуальные проблемы инфекционной патологии и биотехнологии

15. Макеев В.А. Изучение чувствительности бактерий рода Bacillus к различным концентрациям хлорида натрия / В.А. Макеев, М.А. Юдина, А.Х. Мустафин, А.И. Калдыркаев, Н.А. Феоктистова, С.В. Мерчина // Ветеринарная медицина XXI века: инновации, опыт, проблемы и пути их решения Международная научно-практическая конференция, посвященная Всемирному году ветеринарии в ознаменование 250-летия профессии ветеринарного врача. Ульяновск. - 2011. - С. 185-187.

BIOLOGICAL PROPERTIES AND ANTIMICROBIAL

RESISTANCE FLAVOBACTERIUM PSYCHROPHILUM

Vorotnikov A.P., Kafidova A.V., Molofeeva N.I., Vasilyev D.A., Keywords: flavobakterii, aerobic, antibiotic resistance.

Summary. Among the many bacteria that infect fish, Flavobacterium psychrophilum in recent years there is increasing interest. This microorganism is found in all aquatic ecosystems of the world, often in fresh water.

УДК 619:618.7

МИКРОБНЫЙ ФОН ПРИ ЭНДОМЕТРИТАХ

У КОРОВ НА МЕГАФЕРМЕ ООО «КРАСНЫЙ

ВОСТОК»

Воротников А.П., Шокирова С.М., студенты 4 курса факультета ветеринарной медицины Научный руководитель - Терентьева Н.Ю., кандидат ветеринарных наук, доцент

–  –  –

Ключевые слова: воспроизводство, условно-патогенная микрофлора, микробный пейзаж, чувствительность к антибиотикам Аннотация. Работа посвящена изучению микробного пейзажа содержимого матки коров при осложненном течении послеродового процесса и определению устойчивости выделенной микрофлоры к антибактериальным препаратам различных групп.

Исследования в области микробиологии и вирусологии В современных условиях ведения животноводства, особенно в системе мероприятий по увеличению производства животноводческой продукции, работа по воспроизводству стада является очень важной. Значительная роль в недополучении приплода отводится симптоматическому бесплодию, причиной которого часто являются эндометриты. [4,5,8] Главную роль в этом заболевании отводят неспецифической или условно-патогенной микрофлоре, которая весьма распространена в окружающей среде (около 99% всех случаев заражения матки коров приходится на долю условно-патогенной микрофлоры). [1,7,9,10] Поэтому на сегодняшний день предупреждение, своевременное выявление и использование эффективных средств и методов лечения воспалительных заболеваний матки у коров представляют собой актуальную проблему. [2,3,4,6,11] Целью исследований было определение видового состава микрофлоры при эндометритах коров в условиях мегафермы ООО «Красный восток», а также изучения антибиотикорезистентности полученных изолятов.

Материалы и методы. Все работы проводились на кафедре микробиологии вирусологии иммуннологии и ветеринарно-санитарной экспертизы ФГОУ ВПО «Ульяновская ГСХА им.П.А. Столыпина».

Использовались стандартные материалы такие, как МПА, 7% соляной агар. Также применялись среды Гисса и тестовая система производства НииМиВ им Пастера, антибиотикорезистентность проверялась диско диффузным методом на диски производства НЦиФ Инкубирование проводилось в термостатах температурой 37 градусов Цельсия.

Выделение чистой культуры производилось на чашках Петри расеиванием по Дригальскому. Контроль проводился микроскопированием полученной культуры, окрашенной по грамму. После подтверждения монокультуру пересаживали на скошенный полужидкий агар для хранения. Результаты, полученные при изучении биохимии сравнивались с определителем бактерий Берджи.

При изучении антибиотикоустойчивости, использовалась суточная культура, выращенная в пробирках на МПБ. Полученная суспензия, объемом 1 мл. переносилась на МПА для получения газона, выдерживалась 10 минут для осаждения бактерий, излишек МПБ убирался при помощи стерильных пипеток. Далее чашки подсушивались в термостате и на них помещались бумажные диски.

Во всех исследованиях чашки выдерживались при средней температуре 370С, снятие результатов проводилось каждые 24 часа в течение 3 суток.

Результаты исследований и обсуждение. В ходе работ из экссудата были выделены несколько линий монокультуры видов Staphylococcus aureus и Streptococcus pyogenes.

Актуальные проблемы инфекционной патологии и биотехнологии Были изучены свойства полученных изолятов, полученные данные представлены в таблице 1.

–  –  –

Согласно данным приведённым в таблице 1 все четыре изолята является Staphylococcus aureus. Свойства изолятов сравнивались с данными из определителя Берджи, на основе этого были сделаны выводы о видовой принадлежности выделенных бактерий.

Также в одной из проб были получен изолят Streptococcus pyogenes. Его свойства представлены в таблице 2.

–  –  –

У всех выделенных бактерий изучали антибиотикорезистентность. Данное свойство изучалось при помощи диско-диффузного метода. Результаты исследований представлены в таблице 3.

Из полученных данных следует, что наиболее приемлемыми препаратами в плане лечения являются фторхинолы, поскольку все полученные культуры Исследования в области микробиологии и вирусологии бактерий показали высокую чувствительность ко всем препаратом, представленным в этой группе.

Выводы. Биохимия подтвердила, что возбудителями эндометритов коров являлись Staphylococcus aureus и Streptococcus pyogenes. Данные возбудители встречаются повсеместно. Антибиотикоустойчивость данных штаммов достаточно высока. В лечении рекомендуется применять антибиотики фторхинолового ряда поскольку все возбудители показали сильную чувствительность к группе данных препаратов

Библиографический список:

1. Акушерско-гинекологическая диспансеризация в хозяйствах Ульяновской области / Н.Ю. Терентьева, И.Р. Юсупов, С.Н. Иванова, М.А. Багманов // Материалы Международной научно-практической конференции «Аграрная наука и образование на современном этапе развития: опыт, проблемы и пути их решения». – Ульяновск: УГСХА, 2009. – С. 121-127.

2. Динамика некоторых биохимических показателей у коров, больных гнойным пододерматитом / Идогов В.В., Ермолаев В.А., Марьин Е.М., Ляшенко П.М., Сапожников А.В.// Материалы Международной научно-практической конференции, посвященной Всемирному году ветеринарии в ознаменование 250-летия профессии ветеринарного врача. – Ульяновск : УГСХА, 2011.

- С. 131-132

3. Динамика некоторых иммунологических показателей у коров, больных гнойным пододерматитом / Идогов В.В., Ермолаев В.А., Марьин Е.М., Ляшенко П.М., Сапожников А.В.// Материалы Международной научно-практической конференции, посвященной Всемирному году ветеринарии в ознаменование 250-летия профессии ветеринарного врача. – Ульяновск :

УГСХА, 2011. - С. 129-130.

4. Ляшенко П.М. Влияние гидрофильных мазей на гемостазиологические показатели плазмы крови у телят с гнойными ранами/ П.М. Ляшенко, В.А. Ермолаев //Материалы VМеждународной научно-практической конференции «Аграрная наука и образование на современном этапе развития: опыт, проблемы и пути их решения» 2013 год: сборник научных трудов. – Ульяновск :

УГСХА им. П.А. Столыпина, 2013. – С. 104-107.

5. Состояние системы гемостаза, распространенность, этиология и некоторые иммуно-биохимические показатели крови у коров симментальской породы с болезнями копытец /Е.М. Марьин, В.А. Ермолаев, П.М. Ляшенко// Научный вестник Технологического института - филиала ФГБОУ ВПО «Ульяновская ГСХА им. П.А. Столыпина». - 2013. - № 12. - С. 267-273.

Актуальные проблемы инфекционной патологии и биотехнологии

6. Ляшенко, П.М. Морфологические изменения в сосудах при гнойных язвах мякишей у крупного рогатого скота / Ляшенко П.М., Марьин Е.М., Ермолаев В.А.// Материалы Международной научно-практической конференции «Аграрная наука и образование на современном этапе развития: опыт, проблемы и пути их решения». - Ульяновск: УГСХА,2009. - С. 161-164.

7. Микрофлора молока и маточно-цервикального секрета у свиноматок при синдроме метрит-мастит-агалактия / С.Н. Иванова, Н.Ю.Терентьева, М.А.

Багманов, Р.К. Шаев //Ученые записки Казанской государственной академии ветеринарной медицины им. Н.Э. Баумана. - 2010. - Т. 204. - № 1. - С. 111-115.

8. Марьин Е.М. Опыт преподавания ветеринарного предпринимательства в ВУЗЕ / Е.М. Марьин, О.А. Липатова // Материалы научно-методической конференции профессорско-преподавательского состава «Инновационные технологии в высшем профессиональном образовании» - Ульяновск : УГСХА, 2010. - С. 184-186

9. Терентьева Н.Ю. Влияние фитопрепаратов на восстановление воспроизводительной функции коров после отела / Н.Ю. Терентьева, М.А. Багманов // Вестник Ульяновской государственной сельскохозяйственной академии. – 2010.- №1. – С. 82-85.

10. Терентьева Н.Ю. Влияние фитопрепаратов на восстановление воспроизводительной функции коров после отела / Н.Ю. Терентьева, М.А. Багманов // Вестник Ульяновской государственной сельскохозяйственной академии. – 2010.- №1. – С. 82-85.

11. Фармакодинамическое обоснование действия фуратриха при эндометрите коров / Э.К. Рахматуллин, С.А. Борисов, Н.В. Силова, С.Г. Писалева // Вестник Ульяновской сельскохозяйственной академии. – 2014. - №1 (25). – С.98-103.

MICROBIAL BACKGROUND WITH ENDOMETRITIS

COWS ON MEGAFERMY LTD. “THE EAST IS RED”

Vorotnikov A.P., Shokirova S.M., Terentyeva N.Y.

Keywords: reproduction, pathogenic microflora, microbial landscape, sensitivity to antibiotics Summary. The work is devoted to studying the microbial landscape of the uterus of cows in complicated process and post-natal determination of the stability of the selected microflora to antibiotics of different groups.

–  –  –

УДК 619:579

ПРИМЕНЕНИЕ БАКТЕРИОФАГОВ

В КОСМЕТОЛОГИИ

Кармаева С.Г., Загуменнов А.В., студенты 4 курса факультета ветеринарной медицины Благодерова В.В., студентка 1 курса факультета ветеринарной медицины Научный руководитель – Барт Н.Г., кандидат биологических наук, с.преподаватель

–  –  –

Ключевые слова: бактериофаги, микроорганизмы, патогенность, негативные колонии.

Аннотация. Работа посвящена применению бактериофагов в косметологии. Исследованию бактериофагов применяемых при производстве косметики «Сенгара» на специфичность.

В 1896 году английский бактериолог Эрнест Ханкин обнаружил, что вода в индийских реках Ганг и Джамна обладает антибактериальной активностью, и предположил, что в этой воде содержится некая субстанция, не допускающая распространения эпидемии холеры. Первым явление разрушения палочки сибирской язвы наблюдал русский микробиолог Н. Ф. Гамалея в 1898 году. А в 1917 году ученый из института Пастера Феликс Д’Эрель сообщил, что нашел «невидимого микроба», поражающего дизентерийную палочку. Он и дал название «бактериофаг» («пожиратель бактерий») новому микроорганизму. Позднее Д’Эрель описал случай успешного лечения дизентерии с использованием бактериофагов, доказав, что они обеспечивают выздоровление больного организма, а затем и создают специфический иммунитет. Это привлекло к бактериофагам внимание многих исследователей, которые предполагали найти в них действенное средство борьбы с опасными инфекционными болезнями. Бактериофаг состоит из белковой оболочки и генетического материала – нуклеиновой кислоты (ДНК или, реже, РНК). Его размер составляет от 20 до 200 нм. Типичный фаг имеет головку и хвост, который обычно в 2–4 раза превышает диаметр головки. Бактериофаги – самая многочисленная и широко распространенная, а возможно, и наиболее древняя группа вирусов. Они обнаружены для большинства бактерий, и патогенных, и сапрофитных. В природе фаги встречаются там, где имеются чувствительные к ним бактерии: в кишечнике животных и человека, в почве и воде, в растениях и т. д.

Чем богаче субстрат микроорганизмами, тем больше в нем бактериофагов. Бактериофаги узко специфичны: каждый штамм избирательно поражает несколько штаммов бактерий. Бактериофаг прикрепляется к рецепторам на поверхности Актуальные проблемы инфекционной патологии и биотехнологии бактериальной клетки, прокалывает ее оболочку своим хвостом и впрыскивает в нее ДНК, содержащуюся в головке фага.

После этого бактериальная клетка растворяется (происходит ее лизис) и появляются новые зрелые бактериофаги. Так происходит до тех пор, пока не будут разрушены все бактерии данного патогенного штамма. После этого бактериофаги самоуничтожаются. Сегодня при любой бактериальной инфекции врач назначит нам антибиотики – это стандарт лечения.

Однако мы знаем, что антибиотики далеко не безобидны. Да, они убивают патогенную микрофлору, но одновременно уничтожают и полезные микроорганизмы. Кроме того, антибиотики оказывают множество побочных действий на все органы и системы. Еще один их недостаток – строгая схема приема. Принимать антибиотики надо в определенное время, и следует обязательно пройти весь курс. Иначе у бактерий может выработаться устойчивость к этому средству. Антибиотикам есть альтернатива это бактериофаги. Медицина пользуется «услугами»

бактериофагов достаточно давно, а в косметологию они пришли (если о вирусах можно так сказать) относительно недавно. В косметические средства, содержащие бактериофаги обычно добавляют вещества позволяющие последним находиться «в полусонном» состоянии. Делается, это для того, что бы средство можно было хранить при комнатной температуре.

Научные разработки ОАО Фаберлик Средства личной и интимной гигиены разработаны специально для защиты нормофлоры человека. Использование биологических методов защиты микрофлоры – ноу-хау компании Фаберлик. Принцип действия построен на использовании бактериофагов-природных биоограничителей чужеродных (болезнетворных) микроорганизмов. Разработка фаговых коллекций проводится компанией ООО «НПЦ Микромир». В каждое средство введена своя коллекция бактериофагов, активных в отношении одноименных бактерий-патогенов. Способ введения в гель живых активных бактериофагов и сохранение их активности при заявленных условиях хранения – это сложный микробиологический процесс, который запатентован нашим разработчиком Панюшиным С.К. Вся продукция сертифицирована в соответствии с законодательством РФ и имеет Свидетельство о государственной регистрации с экспертным заключением о соответствии продукции Единым санитарно-эпидемиологическим и гигиеническим требованиям к товарам и Декларацию о соответствии. Вся продукция прошла клинические испытания и имеет протоколы: токсикологических исследований, микробиологических испытаний, клинической апробации и химико-аналитических испытаний.

Клинические испытания проводились в ЗАО Медицинском центре косметологической коррекции «ЭКЛАН» и Испытательном лабораторном центре Центральной клинической больницы (ЦКБ РАН). Очень высокая эффективность препаратов Исследования в области микробиологии и вирусологии доказана в Федеральном государственном учреждении здравоохранения «Центр гигиены и эпидемиологии № 133» ФМБА. В 2008 году гигиеническим средствам присуждена Золотая медаль им. Чижевского – высший наградной знак Академии Медико-Технических наук. «За большие заслуги в развитии науки, разработку концепции производства серии биопрепаратов с бактериофагами, развивающей ряд основных положений научных школ академиков РАМН А.А. Воробьева и И.Н.

Блохиной». В декабре 2011 года косметика данной фирмы получила высшую оценку совета «Знак качества ХХI века» и экспертной комиссии. Косметике «Сенгара» присужден «Золотой Знак Качества ХХI века».

Специфичность действия бактериофагов Нами было взято два гель-спрея (гель-спрей для полости рта с бактериофагами и пребиотиками; гель-спрей для рук – биологические перчатки) произведено ООО «НВЦ Агроветзащита С.-П.», Россия, Московская область, г. Сергеев Посад, по заказу ООО «Сенгара» эксклюзивно для ОАО «Фаберлик» и проверено на наличие заявленных бактериофагов (Wolinella Spp., Actinovyces Spp., Actinobacillus actinomycetemcomitans, Porfiromonas gingivalis, Campylobacter Spp., Bacteroides Spp., Staphylococcus aureus, Streptococcus pyogenes, Streptococcus mutans, Pstudomonas aeruginosa, Proteus vulgaris, Klebsiella). Специфичность характеризуется наличием или отсутствием литической активности бактериофагов в отношении гетерологичных бактерий. Изучение специфичности бактериофагов проводили на плотном питательном агаре методом нанесения капель фагов на газон исследуемой культуры.

Изучение специфичности бактериофагов Wolinella Spp., Actinovyces Spp., Actinobacillus actinomycetemcomitans, Porfiromonas gingivalis, Campylobacter Spp., Bacteroides Spp., Staphylococcus aureus, Streptococcus pyogenes, Streptococcus mutans, Pstudomonas aeruginosa, Proteus vulgaris, Klebsiella проводили по отношению к представителям следующих видов: Staphylococcus aureus, Streptococcus pyogenes, Streptococcus mutans, Pstudomonas aeruginosa, Staphylococcus aureus, Klebsiella, Proteus vulgaris.

На поверхность МПА в чашках Петри пипеткой наносили 3-4 капли 18-часовой бульонной культуры исследуемых микроорганизмов. Затем равномерно распределяли по поверхности среды стерильным шпателем. Чашки ставили в термостат для подсушивания на 15-20 минут. После чего на чашках размечали маркером два сектора: на первый сектор засеянного агара легким прикосновением пипетки наносили капли исследуемого бактериофага; на второй сектор по центру в качестве контроля наносили стерильный МПБ. Чашки наклоняли, чтобы капли стекли, а затем инкубировали при температуре 37 С. Оценку результатов проводили через 18-24 часа. Установлено, что заявленные фаги неактивны по отношению к представителям бактерий использованных нами в исследовании, но это не позволяет нам утверждать, что данные бактериофаги не присутствуют в соАктуальные проблемы инфекционной патологии и биотехнологии ставе названных гель-спреев. Взятые нами микрорганизмы из музея кафедры не являются индикаторными культурами, что и не позволило выявить бактериофаги.

–  –  –

1. Бактериофаги в ветеринарии: реальность и перспективы / Л. Натидзе [и др.] // Перспективы использования препаратов бактериофага для превенции и лечения инфекции, вызванных патогенными и условно-патогенными микроорганизмами: матер. междунар. семинара. – Тбилиси. – 2005.

2. Барт Н.Г., Золотухин С.Н., Васильев Д.А. / Н.Г.Барт и др.// Выделение бактериофагов рода Providencia. Ульяновск: УГСХА им. П.А. Столыпина. - 2013.

3. Барт Н.Г. Биологические свойства бактериофагов Providencia / Н.Г. Барт, С.Н.

Золотухин, Д.А. Васильев // Актуальные вопросы аграрной науки и образования: Материалы Международной научно-практической конференции.

– Ульяновск, 2009. – С. 6-8.

4. Барт Н.Г. Спектр литической активности бактериофагов Providencia / Н.Г.

Барт, С.Н. Золотухин, Д.А. Васильев // Актуальные вопросы аграрной науки и образования: Материалы Международной научно-практической конференции. – Ульяновск, 2013. – С. 12-15.

5. Галушко И.С., Еремина Т.А., Барт Н.Г. Выделение фагов бактерий рода Providencia из объектов внешней среды и патологического // Материалы V Международной студенческой электронной научной конференции «Студенческий научный форум» URL: www.scienceforum.ru/2014/6 66/2961

6. Гольдфарб Д.М. Бактериофагия / Д.М. Гольдфарб // М.: Медгиз. – 1961.

7. Покровский В.И. Медицинская микробиология. / В.И. Покровский, О.К. Поздеев – М.: Медицина. – 1999.

8. Золотухин С.Н. Изучение чувствительности Е.coli к колифагам / С.Н. Золотухин, Н.И. Молофеева, Д.А. Васильев // Вестник Ульяновской государственной сельскохозяйственной академии. Ульяновск. - 2001. - № 11. - С. 59.

9. Золотухин С.Н. Чувствительность патогенных энтеробактерий, выделенных при диареях молодняка животных к антибиотикам и специфическим бактериофагам / С.Н. Золотухин, А.С. Мелехин, Д.А. Васильев, Л.С. Каврук, Н.И.

Молофеева, Л.П. Пульчеровская, Б.М. Коритняк, Е.А. Бульканова // Профилактика, диагностика и лечение инфекционных болезней, общих для людей и животных. Ульяновск. - 2006. - С. 233-236.

10. Золотухин С.Н. Выделение и селекция клонов бактериофагов патогенных энтеробактерий / С.Н. Золотухин, Д.А. Васильев, Л.С. Кавруг, Н.И. Молофеева, Л.П. Пульчеровская, Б.М. Коритняк, Е.А. Бульканова, Н.А. Феоктистова, Е.Н. Пожарникова, А.С. Мелехин, Н.Г. Барт, Н.П. Катмакова // Профилактика, Исследования в области микробиологии и вирусологии диагностика и лечение инфекционных болезней, общих для людей и животных. Ульяновск. - 2006. - С. 227-230..

11. Золотухин С.Н. Штаммы бактериофагов малоизученных патогенных энтеробактерий и их практическое применение / С.Н. Золотухин, Д.А. Васильев, Л.С.

Каврук, Л.П. Пульчеровская, Н.И. Молофеева, Б.М. Коритняк, А.Ю. Кузнецов, Е.А. Бульканова, Е.Н. Пожарникова, Н.А. Феоктистова, А.С. Мелехин, С.В. Ленев // Научные разработки и научно-консультационные услуги Ульяновской ГСХА. Информационно-справочный указатель. Ульяновск. - 2006. - С. 45-49.

12. Потатуркина-Нестерова Н.И. Атомно-силовая микроскопия как метод исследования в микробиологии / Н.И. Потатуркина-Нестерова, И.С. Немова, А.В.

Даньшина // Современные проблемы науки и образования. - 2012. - № 3.

- С. 316.

13. Елистратова Л.Л. Современное состояние проблемы демодекоза / Л.Л.

Елистратова, Н.И. Потатуркина-Нестерова, А.С. Нестеров // Фундаментальные исследования. - 2011. - № 9-1. - С. 67-69.

14. Потатуркина-Нестерова Н.И. Изменение вирулентных свойств урогенитальных энтерококков в условиях межмикробных взаимоотношений / Н.И.

Потатуркина-Нестерова, И.С. Немова, М.Н. Артамонова, Е.Б. Хромова, О.Е.

Хохлова, Н.В. Трофимова, О.В. Теплякова, И.А. Кочергина // Современные проблемы науки и образования. - 2013. - № 1. - С. 8.

15. Белозерова Е.А. Влияние хронического поступления солей меди, цинка и свинца на микробиологический баланс толстой кишки в условиях эксперимента / Е.А. Белозерова, Н.И. Потатуркина-Нестерова, Е.С. Климов. -Токсикологический вестник. - 2007. - № 4. - С. 26-30.

16. Яцишина С.Б. Применение мультиплексной ПЦР для идентификации вирулентных форм возбудителя сибирской язвы / С.Б. Яцишина, И.Л. Обухов, Л.С. Саленко, Б.И. Шморгун и др. // Сб. тезисов Генодиагностика инфекционных заболеваний. Всеросс. науч.-практич. Конференция. – 2002.

17. Основные биологические свойства листериозных бактериофагов / Е.В. Сульдина, Д.А. Васильев, Е.Н. Ковалева // Материалы VI Международной научно-практической конфе¬ренции «Аграрная наука и образование на современном этапе разви¬тия: опыт, проблемы и пути их решения». Часть III / Ульяновск, ГСХА им. П.А.Столыпина. - 2015. – С.125-127.

18. Васильева Ю.Б. Изучение чувствительности и диагностической эффективности тeст-cистемы индикации и идентификации бактерий B. bronchiseptica / Ю.Б. Васильева, А.В. Мастиленко, Д.А. Васильев, Р.Р. Бадаев, С.В. Мерчина, И.Г. Швиденко, А.С. Скорик // Современные проблемы науки и образования. - 2014. - № 5. - С. 596.

Keywords: bacteriophages, microorganisms, pathogenicity, negative colonies.

Work is devoted to application of bacteriophages in cosmetology. To research of the bacteriophages applied by production of cosmetics of “Sengar” on specificity.

УДК 612.7

ИССЛЕДОВАНИЕ МИКРОБИОЦЕНОЗА КОЖИ

ПОДМЫШЕК ЧЕЛОВЕКА

Кафидова А.В., студентка 3 курса факультета ветеринарной медицины Научный руководитель – Мухитова М.Э., кандидат биологических наук, старший преподаватель

–  –  –

Ключевые слова: микробиоценоз кожи, триклозан, метод Коростелева.

Аннотация. В данной работе мы провели исследования на качество применения средств по уходу за кожей, в частности гелей для душа, тоников и молочка для лица, очищающих средств, различных видов мыла (хозяйственное, детское, дегтярное, антибактериальное) и дезодорантов.

Тело человека является хорошей средой для размножения микроорганизмов. Здоровый человек переносит на коже до триллиона микроорганизмов.

Микроорганизмы кожи человека являются самостоятельной экосистемой, живя с человеком в симбиозе, они препятствуют развитию патогенной микрофлоры, а так же развитию дерматологических заболеваний кожи [6].

Симбионтные взаимоотношения микроорганизмов устанавливаются и с беспозвоночными животными, например с люмбрицидами [1; 2; 3]. Процесс симбионтого пищеварения в кишечнике дождевых червей позволяет разлагать сложные органические субстраты до простых доступных для растений элементов[4; 5].

Для характеристики состояния микробиоценоза кожи применяют простой метод, основанный на среде Коростелева, который не вызывает отрицательной реакции у взрослых и детей и позволяет проводить широкие массовые обследования [6]..

Исследования в области микробиологии и вирусологии Микробиоценоз здоровой кожи - это устойчивая к внешним воздействиям экосистема. Нормальное состояние кожи - кислое, оно поддерживается секретом потовых желез, кожным салом, расщеплением жирных кислот, эпидермальным стафилококком. Поэтому считается, что резидентный микробиоценоз кожи (т.е. нормофлора) также частично поддерживает кислую рН кожи [6].

Цель работы: сравнительная оценка микробиоценоза разных участков кожи человека до и после применения косметических средств.

Задачи:

1. Исследование участков кожи до применения косметических средств;

2. Оценка влияния косметических средств на микробиоценоз кожи.

Материалы и методы. Для изучения микрофлоры кожи человека были использованы пластинки с питательной средой Коростелева. Определение количества микроорганизмов проводили путем подсчета числа колоний на отпечатке.

На следующем этапе работы выделяли чистую культуру, проводили микроскопию мазков и биохимические тесты.

Для контроля 1-2 пластинки из партии оставили в чашках неиспользованными с целью наблюдения за качеством среды и ростом микроорганизмов из воздушной среды [6].

Посевы-отпечатки брали с кожи подмышек. Для изменения pH и влажности кожи использовали дезодорант шариковый, спрей-дезодорант.

Определяли более подходящую среду для роста на коже подмышек микроорганизмов, а так же исследовали эффективность и качество таких косметических средств, как различные виды дезодорантов. Перед снятием отпечатков сначала обрабатывали кожу каждым из дезодорантов по очереди для просмотра изменения бактериальной массы в новых условиях, а так же сделали отпечаток и с неочищенной кожи в качестве контроля.

Результаты исследований и обсуждение. На среде Коростелева, содержащей маннит и бромтимолблау, выросли колонии различного цвета: белые, зеленые, а также желтые. Окраска колоний в желтый цвет обусловлена биохимической активностью микроорганизмов, которые вырабатывали фермент, сбраживающий маннит с образованием кислоты. В кислой среде бромтимолблау (краситель) имел желтую окраску, и эти колонии также приобретали желтый цвет. Установлено, что способность сбраживать маннит является одним из показателей патогенности стафилококков.

Было выделено несколько видов микроорганизмов. Локальное распространение зависит от того, насколько pH и влажность кожи отличаются от других участков. Проведя типирование микроорганизмов на базе литературных и полученных в ходе работы данных, мы определили микробиоценоз кожи подмышек до применения косметических средств и после.

Актуальные проблемы инфекционной патологии и биотехнологии Общее число колоний, выросших на среде Коростелева, с отпечатков кожи подмышек до применения косметических средств брали за 100 %. Далее рассчитывали долю Brevibacterium spp., Propionibacterium avidum, Corynebacterium minutissimum в микробиоценозе кожи подмышек.

Оценку микробиоценоза кожи подмышек после применения шарикового дезодоранта и дезодоранта-спрея проводили от числа колоний, выросших до применения (выросшие до применения колонии в данном случае считались как 100%).

До применения косметических средств область подмышек заселяли Brevibacterium spp, Propionibacterium avidum, Corynebacterium minutissimum. Преобладающее место занимал род Brevibacterium (42% от общего числа микроорганизмов на подмышке до применения косметических средств). Эта бактерия представляет собой грамположительную, непатогенную палочку.

Содержание Propionibacterium avidum и Corynebacterium minutissimum было ниже, они составили 31% и 27% соответственно (таблица 1).

–  –  –

После применения шарикового дезодоранта и спрей-дезодоранта видовое разнообразие колоний сохранилось прежним, но количественное содержание микроорганизмов после применения спрей-дезодоранта стало на 73% меньше, а в случае применения шарикового дезодоранта их количество сократилось на 81%. Следовательно, шариковый дезодорант более интенсивно угнетал развитие бактерий, чем спрей-дезодорант Мы считаем, что угнетение роста бактерий связано с химическим составом дезодорантов. В составе используемых дезодорантов содержался триклозан - антибактериальный агент широкого спектра, который подавляет рост бактерий, препятствуя распространению запаха, выделяемого этими бактериями. Как правило, дезодоранты, содержащие триклозан, устраняют запах за счет своей способности подавлять рост бактерий, но не ослабляют потоотделение. К отрицательным свойствам триклозана относится, что он в виду своего химического строения, влияет на гормональный фон человека.

Исследования в области микробиологии и вирусологии

Библиографический список:

1. Романова Е.М. Повышение эффективности вермикультуры EISENIA FETIDA (SAVIGNY, 1826) в условиях симбионтного сообщества /Е.М. Романова, М.Э.

Мухитова, Д.С. Игнаткин// Тезисы III Международной виртуальной Интернет - конференции «Биотехнология. Взгляд в будущее», 25-26 марта 2014.

– С. 83-87.

2. Мухитова М.Э. Характеристики микробиоценоза вермикомпостов люмбрицид / М.Э. Мухитова// Объединенный научный журнал – Москва: Изд-во АНП - №12. – 2008. – С.45-47.

3. Романова Е.М. Исследование перспектив использования природных видов люмбрицид Средневолжского региона в технологиях вермикомпостирования /Е.М. Романова, М.Э. Мухитова, Д.С. Игнаткин// Молодежь и наука XXI века: Мат-лы III Междунар. научно-практ. конф. молодых ученых. - Ульяновск, 2010. – С. 237-241.

4. Романова Е.М. Роль люмбрицид в формировании микробиоценоза вермикомпостов / М.Э. Мухитова, Е.В. Титова// Аграрная наука и образование на современном этапе развития: опыт, проблемы и пути их решения. Мат-лы Междунар. научно-практ. конф. - Ульяновск, 2009. - С. 155-158.

5. Мухитова М.Э. Изменение химического состава природных субстратов в процессе биоконверсии вермикультивированием/ Е.В. Титова, М.Э. Мухитова// Проблемы экологии и охраны природы. Пути их решения: Мат-лы III Всеросс. научно-практ. конф. - Ульяновск: УлГУ, 2006. - С. 155-158.

6. Воробьев А.А. Медицинская и санитарная микробиология: учебное пособие / А.А. Воробьев, Ю.С. Кривошеин, В.П. Широбоков // М., 2008 – 464 с.

STUDY MICROBIOCENOSIS HUMAN

SKIN ARMPITS

Kafidova A.V.

Keywords: microbiocenosis skin, triclosan, method Korostelyova Summary. In this paper, we have investigated the quality of application of skin care products, such as shower gels, tonics and milk facial cleansers, soaps of various kinds (economic, baby, tar, antibacterial) and deodorants.

Актуальные проблемы инфекционной патологии и биотехнологии УДК 616:619

БИОХИМИЧЕСКИЕ ОСОБЕННОСТИ

МЕТАБОЛИЗМА УГЛЕВОДОВ БАКТЕРИЯМИ

РОДА BORDETELLA

Ломакин А.А., студент 2 курса факультета ветеринарной медицины Научные руководители – Мастиленко А.В., кандидат биологических наук, старший преподаватель, Васильев Д.А., доктор биологических наук, профессор

–  –  –

Ключевые слова: Bordetella, метаболизм углеводов, особенности, B.

bronchiseptica.

Аннотация. В статье представлен обзор литературных источников по проблеме биохимических особенностей метаболизма углеводов бактерий рода Bordetella. Авторами проведены собственные исследования особенностей метаболизма простых и сложных углеводов на примере бактериальных культур B. bronchiseptica. Полученные результаты свидетельствуют о слабо выраженном метаболизме глюкозы и ксилозы данными бактериальными культурами, при этом время инкубации и учета результатов были значительно увеличены в сравнении с общепринятой методикой до 48 часов.

Бактерии рода Bordetella в настоящее время ассоциируются с респираторными заболеваниями человека и животных. К данному роду относятся давно охарактеризованные микроорганизмы B.pertussis, В.parapertussis, В.bronchiseptica («классические» Bordetella), сравнительно недавно описанные В.avium и выделенные в последние годы B.petrii, B.holmesii, B.hinzii, B.trematum, B.ansorpii («новые» Bordetella). [1, 2, 3, 10, 15-19].

Большинство патогенных штаммов бактериальных видов рода Bordetella имеет полный набор факторов патогенности, присущих данному роду: фимбрии (Fim), филаментозный гемагглютинин (FHA), секреция факторов адгезии и колонизации (III тип секреции), некоторые виды включают также в свой арсенал патогенности дермонекротический токсин (DNT), остеотоксин, аденилатциклазный токсин (АCT), трахеальный цитотоксин (TCT), липополисахарид (LPS), и только B.pertussis и В.parapertussis секретируют также коклюшный токсин (PTX).

Бактериальные клетки представляют собой коккобациллы, имеющие средние размеры 0,2-0,50,5-2,0 мкм. Однако в старых культурах их размеры значительно увеличиваются, что свидетельствует о дезорганизации процессов пластического обмена и накоплении продуктов обмена в условиях снижения Исследования в области микробиологии и вирусологии количества необходимых компонентов и их качества для полноценной жизнедеятельности бактериальных клеток. Капсула была обнаружена лишь у трех видов B. pertussis, B. bronchiseptica, и B. trematum [10].

Все виды рода Bordetella являются облигатными аэробами. Основой их метаболизма является окисление аминокислот [2, 10]. По данным Weiss (1992) углеводы не используются данными бактериями. В то же время, они являются ауксотрофами по некоторым неорганическим и органическим веществам (неорганической сере, никотинамиду, метионину, цистину, цистеину или глутатиону) [4]. За исключением B.pertussis бактериальные виды данного рода прекрасно растут на широко используемых синтетических и полусинтетических средах (агаре МакКонки, пептоном агаре, триптикозо-соевом агаре с добавлением 5% крови, средах на основе сердечного экстракта) [5].

Несмотря на филогенетическое родство, многими авторами отмечается фенотипический плеоморфизм бактериального роста при культивировании различных видов рода Bordetella [4, 10]. Так только B. holmesii и В. parapertussis на средах с тирозином образуют характерный коричневый пигмент, активно диффундирующий в окружающую среду [7]. Высокая активность уреазы характерна для B. holmesii и В. parapertussis. Однако стоит отметить, что B. bronchiseptica также экспрессирует данный фермент, однако его активность не сопоставима с вышеуказанными видами. Оксидазная активность характерна для большинства видов Bordetella, исключением являются B. holmesii, В. parapertussis, B. trematum. Редукция нитратов является весьма вареабельным признаком лишь для вида B. bronchiseptica, в остальных случаях отмечается отрицательная реакция.

По данным Rowatt (1955) при культивировании B.pertussis, В.parapertussis, В.bronchiseptica на среде с глутаматом скорость роста бактериальных культур резко снижается при уменьшении на 10 % исходного его количества. Однако, как отмечает автор, наблюдается неоднородность этой закономерности для данных бактериальных видов. Так в процессе метаболизма глутамата образуется аммиак, вследствие чего отмечается повышение рН среды с 7,0 до 7,3.

Это обстоятельство служит ингибитором нормально роста для B.pertussis и В.bronchiseptica. Однако начало снижения скорости роста бактериальной культуры В.parapertussis было несколько отдалено во временном интервале от вышеуказанных видов. Причем, как отмечает Rowatt, количество использованного бактериальными клетками глутамата было эквивалентно образованному аммиаку для B.pertussis и В.parapertussis; при анализе метаболизма В.bronchiseptica оказалось, что количество образованного аммиака было значительно больше количества деградированного глутамата [6].

В исследованиях Ensmingerp (1953) отмечается, что при исследовании метаболизма аминокислот бактериями рода Bordetella с помощью хроматографии Актуальные проблемы инфекционной патологии и биотехнологии на бумаге в процессе их культивирования на питательных средах наблюдается дезаминирование аминокислот по убывающей по следующей закономерности:

аспарагиновая кислота, серин, глицин, глутамат, аланин и пролин. При культивировании В.bronchiseptica, кроме указанных аминокислот наблюдалась также деградация лейцина. Другие аминокислоты были обнаружены автором на хроматограмме в исходном количестве, т.е. не были дезаминированы бактериальными клетками. Единственным новым азотсодержащим соединением оказался пигмент у В.parapertussis, который располагался на хроматограмме выше валина и метионина, и представлял собой продукт дезаминирования тирозина на поздних стадиях бактериального роста [7].

В исследованиях Lautrop et al. (1960) отмечается, что бактерии рода Bordetella окисляют глюкозу, однако значительно слабее других микроорганизмов.

Так авторами была использована среда следующего состава: пептон - 0,2 % ;

NaCl - 0,5 % ; K2HPO4 - 0,03 % ; агар - 0,3 % ; бромтимоловый синий - 0,003 % ;

глюкоза - 1,0 % ; рН - 7,1. При посеве в полужидкой среде происходило медленное окисление глюкозы на поверхности агара с постепенным уменьшением визуализации изменения окраски среды по ходу посева сверху вниз. Исследователи обращают внимание, что данная реакция не должна рассматриваться как отрицательная, учитывая окислительный характер ферментации, и может наблюдаться на протяжении нескольких дней инкубации [8].

На основании полногеномного секвенирования ДНК различных штаммов рода Bordetella в исследованиях Parkhill et al. (2003) было показано отсутствие полного генетического кластера гликолитического цикла. По данным авторов у всех бактериальных видов рода Bordetella отсутствуют гены основных ферментов АТФ-зависимых реакций фосфорилирования глюкозы: глюкокиназы, фосфорилирующей глюкозу до глюкозо-6-фосфата, и 6-фосфофруктокиназы, превращающей глюкозо-6-фосфат в фруктозо-1,6-бифосфат. Более того, у бордетелл авторами не обнаружено функционирующих систем фосфотрансфераз углеводов, несмотря на то, что у некоторых видов, например В.bronchiseptica, B.pertussis и В.parapertussis, имеются гены, детерминирующие данные ферменты [2, 9].

Гликонеогенез бактериальных видов Bordetella начинается с дефосфорилирования пирувата или фосфоенолпирувата, образующихся в результате переаминирования аминокислот, используемых бактериальными клетками в пластическом обмене, синтезе полисахарида и ароматических аминокислот. По данным Barabote et al. (2005) гликонеогенез не имеет родовых и, тем более, каких-либо видовых особенностей [9].

По данным Thalen et al. (1999) некоторые патогенные бордетеллы (например, B. pertussis) также обладают частично дисфункциональным циклом трикарбоновых кислот. Авторы отмечают, что данные виды не способны синИсследования в области микробиологии и вирусологии тезировать цитрат из оксалацетата и ацетила-Со-А, и использовать пируват в качестве единственного источника энергии, т. е. данные метаболические пути оказались неактивными [11].

По данным большинства современных исследователей следует, что бактериальные виды Bordetella не способны ферментировать простые и сложные углеводы вследствие неактивности соответствующих ферментативных систем. В то же время, большинство исследований, касающихся генома бактерий данного рода, содержат данные, однозначно указывающие на наличие соответствующих генов в их геноме [12, 13, 14].

Данных, в которых представлены доказательства того, что бордетеллы являются микроорганизмами, обладающими слабым метаболизмом углеводов, в настоящее время представлено достаточно мало, однако, на наш взгляд, для более глубокого понимания данного вопроса требуются более детальные исследования, включающие в себя, в том числе, анализ условий протекания процессов окисления в слабо выраженной форме.

Таким образом, мы поставили перед собой целью исследование биохимических особенностей метаболизма углеводов бактериями рода Bordetella. Первоочередной задачей являлось исследование метаболизма углеводов бактериальными культурами В.bronchiseptica. Выбор объекта исследований основан на том, что данный вид не требует особых условий культивирования и обладает оптимальной скоростью роста.

Материалы и методы. В работе были использованы культуры B. bronchiseptica из коллекции кафедры микробиологии, вирусологии, эпизоотологии и ветеринарно-санитарной экспертизы Ульяновской государственной сельскохозяйственной академии им. П.А. Столыпина, которые в соответствии с паспортными данными, обладали типичными для бактерий этих видов морфологическими, культуральными и биохимическими свойствами.

В работе были использованы среды Гисса с углеводами (НПО «Питательный среды», г. Махачкала), термостат ТС-80М-2, автоклав ГК-100-3, шкаф сушильно-стерилизационный ШСС-80п УХЛ 424, холодильная камера, установка бактерицидная УГД-2, лабораторная бактериологическая посуда, наконечники до 1000 мкл. с аэрозольным фильтром.

Биохимические свойства бордетелл исследовали согласно общепринятым в микробиологии методикам: инструкция по бактериологическому и серологическому исследованиям при коклюше и паракоклюше (для бактериологических лабораторий санитарно-эпидемиологических станций и больниц) Минздрава СССР Москва 1984 г.; инструкции по применению набора для определения биохимических свойств НИИЭМ им Пастера; Методы общей бактериологии в трех томах под редакцией Ф. Герхарда и др. Москва “Мир” 1984; - А.С. Лабинская.

Микробиология с техникой микробиологических исследований. Изд 4-е, перераб. и доп. М., “Медицина”, 1978 г.

Результаты исследований. В процессе исследования были приготовлены среды Гисса с соответстующими углеводами. В качестве индикатора был использован бромкрезоловый пурпурный и бромтимоловый синий.

Среды содержали агар в концентрации 0,5%. Посевы был произведены методом укола в столбик. Таким образом, мы могли наблюдать изменение цвета среды по ходу посева. Условия культивирования были следующими: 37°С 18часов.

Через 18 часов изменение цвета и характера среды мы не наблюдали ни в одной из пробирок с углеводами. Через 24 часа в пробирках с глюкозой цвет среды в верхней части среды изменился незначительно, но визуально отличимо от основной среды и отрицательного контроля. Через 48 часов в пробирках с глюкозой мы наблюдали четкое изменение цвета в верхней части среды, с уменьшением визуализации изменения в толще среды. Также через 48 часов наблюдалась положительная реакция утилизации ксилозы у всех исследуемых штаммов. Результаты представлены в таблице 1.

Выводы. В результате проведенных экспериментов были исследованы биохимические особенности метаболизма углеводов бактериями рода Bordetella на примере культур B. bronchiseptica. Полученные результаты свидетельствуют о слабо выраженном метаболизме глюкозы и ксилозы данными бактеИсследования в области микробиологии и вирусологии риальными культурами, при этом время инкубации и учета результатов были значительно увеличены в сравнении с общепринятой методикой до 48 часов.

Возможность контаминации нами исключена на основании отрицательных контролей. На основании полученных данных считаем необходимым проведение дальнейших исследований связанных с метаболизмом углеводов у бактерий рода Bordetella с увеличенными сроками культивирования и различными температурными режимами; а также исследований, связанных с идентификацией наличия соответствующих генов, кодирующих основные ферментные комплексы метаболизма, и их экспрессии при воздействии различных внешних факторов при культивировании.

Библиографический список:

1. Goodnow R.A. Biology of B.bronchisеptica / Microbiol. Rev. - 1980. – V.44. – P.722-738.

2. Сomparative analysis of the genome sequences of B. pertussis, B. parapertussis and B.bronchiseptica / J. Parkhill [et al.] // Nature genetics Advance online publication. – 2003. – V.10. – P.1038-1227.

3. New species of Bordetella, Bordetella ansorpii sp. nov., isolated from the purulent exudate of an epidermal cyst / Kwan Soo Ko [et al.] // Journal of clinical microbiology. – 2005. – N.6. – Р. 2516-2519.

4. Weiss, A.A. The genus Bordetella. In Balows, Truper, Dworkin, Harder and Schleifer (Editors), The Prokaryotes: a Handbook on the Biology of Bacteria: Exophysiology, Isolation, Identification, Applications., 2nd Ed., Vol. 3, Springer-Verlag, Berlin, Germany. – 1992. P. 2530–2543.

5. Hoppe, J.E. Bordetella. In Murray, Baron, Phaller, Tenover and Yolken (Editors), Manual of Clinical Microbiology, American Society for Microbiology, Washington DC. – 1999. P. 614–624.

6. Rowatt, E. Amino Acid Metabolism in the Genus Bordetella / J. gen. Microbiol. V.13. - P.552-560

7. Ensmingerp, W. Pigment production by Haemophilus parapertussis / J. Bact. – 1953. – V.65. – P.509.

8. Lautrop, H. Laboratory Diagnosis of Whooping-cough or Bordetella Infections / H. Lautrop, B. W. Lacey and B. Sc. / Bull. Wld Hlth Org. - 1960. - V.23. - P. 15-35.

9. Barabote R. D., Saier M. H. Comparative genomic analyses of the bacterial phosphotransferase system //Microbiology and Molecular Biology Reviews. – 2005.

– Т. 69. – №. 4. – С. 608-634.

10. Васильев Д.А., Васильева Ю.Б., Мастиленко А.В., Сверкалова Д.Г., Семанина

Е.Н., Борисова О.Ю., Золотухин С.Н., Швиденко И.Г. Бордетеллёз животных:

Актуальные проблемы инфекционной патологии и биотехнологии характеристика заболевания и возбудителя, разработка методов диагностики: моногр. Ульяновск: Изд. Ульяновской государственной сельскохозяйственной академии им. П.А. Столыпина, 2014. 206 с.

11. Thalen M. et al. Rational medium design forBordetella pertussis: basic metabolism //Journal of biotechnology. – 1999. – Т. 75. – №. 2. – С. 147-159.

12. Moran N. A., Plague G. R. Genomic changes following host restriction in bacteria // Current opinion in genetics and development. – 2004. – Т. 14. – №. 6. – С.

627-633.

13. Mattoo S., Cherry J. D. Molecular pathogenesis, epidemiology, and clinical manifestations of respiratory infections due to Bordetella pertussis and other Bordetella subspecies //Clinical microbiology reviews. – 2005. – Т. 18. – №. 2. – С.

326-382.

14. Sebaihia M. et al. Comparison of the genome sequence of the poultry pathogen Bordetella avium with those of B. bronchiseptica, B. pertussis, and B. parapertussis reveals extensive diversity in surface structures associated with host interaction //Journal of bacteriology. – 2006. – Т. 188. – №. 16. – С. 6002-6015.

15. Сверкалова Д.Г.Создание транспортной и накопительной сред для Bordetella bronchiseptica / Д.Г. Сверкалова, А.В. Мастиленко, Д.Н. Хлынов, Ю.Б. Никульшина, Д.А. Васильев // Актуальные вопросы аграрной науки и образования Материалы Международной научно-практической конференции, посвященной 65-летию Ульяновской ГСХА. Ульяновск. - 2008. - С. 134-136.

16. Никульшина Ю.Б. Культивирование Bordetella bronchiseptica на различных селективных средах / Ю.Б. Никульшина, Д.Г. Сверкалова, А.В. Мастиленко, Д.Н. Хлынов, Д.А. Васильев // Актуальные вопросы аграрной науки и образования Материалы Международной научно-практической конференции, посвященной 65-летию Ульяновской ГСХА. Ульяновск - 2008. - С. 57-59.

17. Васильев Д.А. Индикация Bordetella bronchiseptica из объектов внешней среды и клинических образцов / Д.А. Васильев, Ю.Б. Васильева, Е.Н. Семанина, Е.Г. Семанин // Аграрная наука и образование на современном этапе развития: опыт, проблемы и пути их решения Материалы V Международной научно-практической конференции. Ульяновск: ГСХА им. П.А. Столыпина. -2013. - С. 18-22.

18. Никульшина Ю.Б. Разработка методов индикации и идентификации Bordetella bronchiseptica, выделенных у домашних животных / Ю.Б. Никульшина, Д.Г.

Сверкалова, Е.Н. Никулина // Ветеринарная патология. 2007. - № 4. - С. 103-106.

19. Васильева Ю.Б. Изучение чувствительности и диагностической эффективности тeст-cистемы индикации и идентификации бактерий B. bronchiseptica / Ю.Б. Васильева, А.В. Мастиленко, Д.А. Васильев, Р.Р. Бадаев, С.В. Мерчина, И.Г. Швиденко, А.С. Скорик // Современные проблемы науки и образования. - 2014. - № 5. - С. 596.

Исследования в области микробиологии и вирусологии

BIOCHEMICAL CHARACTERISTICS OF THE

METABOLISM OF CARBOHYDRATES BY BACTERIA

OF THE GENUS BORDETELLA

Lomakin, A. A., Mastilenco A.V., Vasiliev D.A.

Key words: Bordetella, metabolism of carbohydrates, features, and B.

bronchiseptica.

Summary. The article presents a literature review on the problem of biochemical characteristics of carbohydrate metabolism in bacteria of the genus Bordetella. The authors have conducted their own studies of the metabolism of simple and complex carbohydrates for example bacterial cultures of B.bronchiseptica. The results indicate a poorly-defined the metabolism of glucose and xylose data bacterial cultures, incubation time and results were significantly increased in comparison with the conventional technique to 48 hours.

УДК 616:619

РАЗРАБОТКА СИСТЕМЫ МОЛЕКУЛЯРНОГЕНЕТИЧЕСКОЙ ИДЕНТИФИКАЦИИ

CORYNEBACTERIUM ULCERANS НА ОСНОВЕ

ПЦР В РЕЖИМЕ «РЕАЛЬНОГО ВРЕМЕНИ»

Ломакин А.А., студент 2 курса факультета ветеринарной медицины Научные руководители - Полетаева Т.Н., Макшанова Н.В., младшие научные сотрудники

ФГБОУ ВПО «Ульяновская ГСХА им П.А. Столыпина»

Ключевые слова: ПЦР, молекулярно-генетическая индификация, C.

ulcerans, C. diphtheria Аннотация. Статья посвещена разработке молекулярно-гентической индификации C. ulcerans на основе метода ПЦР в режиме “ реального времени”. В результате проведенных экспериментов нами было обнаружено, что олигонуклеотиды и флуоресцентный зонд с красителем R6G, фланкирующие фрагмент гена uvrB системы UvrABC protein B являются видоспецифичными для C. ulcerans.

В последнее время инфекциям, ассоциированным с Corynebacterium ulcerans, стали уделять особое внимание как в ветеринарной практике, так и в медицине. Так D. Taylor et al. (2002) сообщили об изоляции вирулентных штаммов этого возбудителя от домашних кошек. C. ulcerans способна вызывать инфекции верхних дыхательных путей, чаще всего ассоциированные с клиническими симптомами фарингита.

Почти все случаи поражения вирулентными штаммами C. ulcerans характеризовались симптомами схожими с классической дифтерией. Это объясняется наличием в хромосоме возбудителя генов умеренного конвертирующего -профага, названного коринефагом, и несущим оперон дифтерийного токсина [1].

Бактериологическая идентификация представителей рода Corynebacterium достаточно сложна, поэтому неоднократно были предприняты попытки их межвидовой дифференциации с применением молекулярно-генетических методов. Частичное секвенирование 16s рРНК гена используют для сложнодифференцируемых бактериальных видов, однако этот подход обладает существенными ограничениями для межвидовой дифференциации членов одного рода.

Нами была поставлена цель разработать систему детекции C. ulcerans на основе ПЦР в режиме «реального времени».

Исследования в области микробиологии и вирусологии Материалы и методы. Работа была выполнена на базе отдела молекулярной биотехнологии кафедры микробиологии, вирусологии, эпизоотологии и ветеринарно-санитарной экспертизы Ульяновской ГСХА им П.А. Столыпина.

В работе были использованы штаммы C. ulcerans, C. diphtheriae, C.

xerosis, C. jeikeium, C. minutissimum из музея кафедры, олигонуклеотиды CUC-f GACGCAGCTATTGCGGAGAA и CUC-r TGAGCTCGGATATAAGCGCC, и флуоресцентный зонд CUC-oligo R6GGCGCGATCTTTCTACTATGCCCGC BHQ. Для амплификации в работе использовали «Набор реагентов для проведения ПЦР-РВ с Taq–ДНК–полимеразой и ингибирующими активность фермента антителами» («Синтол», Москва), а также детектирующий амплификатор ДТ-96 («ДНК-Технология», Москва).

Результаты исследований. Нами были разработаны олигонуклеотиды и флуоресцентный зонд для детекции C. ulcerans при использовании метода ПЦР в режиме «реального времени». В качестве мишени был выбран участок гена uvrB системы UvrABC protein B. Результаты амплификации отражены в таблице 1.

Выводы. В результате проведенных экспериментов нами было обнаружено, что олигонуклеотиды и флуоресцентный зонд с красителем R6G, фланкирующие фрагмент гена uvrB системы UvrABC protein B являются видоспецифичными для C. ulcerans. При исследовании чувствительности данной системы с последовательными 10-и кратными разведениями исходной ДНК были получены результаты накопления флуоресцентного сигнала амплификации в максимальном разведении х106 с данными Ср=40,6.

Данная система праймеров и флуоресцентного зонда может быть использована для видовой идентификации Corynebacterium ulcerans.

Библиографический список:

1. Васильева, Ю.Б. Изучение чувствительности и диагностической эффективности тecт-cистемы индикации и идентификации бактерий B. bronchiseptica/ Ю.Б. Васильева, А.В. Мастиленко, Д.А. Васильев, Р.Р. Бадаев,С.В. Мерчина, И.Г. Швиденко, А.С. Скорик//Современные проблемы науки и образования. -2014. -№ 5; URL: http://www.science-education.ru/119-14770.

2. Сверкалова Д.Г.Создание транспортной и накопительной сред для Bordetella bronchiseptica / Д.Г. Сверкалова, А.В. Мастиленко, Д.Н. Хлынов, Ю.Б. Никульшина, Д.А. Васильев // Актуальные вопросы аграрной науки и образования Материалы Международной научно-практической конференции, посвященной 65-летию Ульяновской ГСХА. Ульяновск. - 2008. - С. 134-136.

3. Никульшина Ю.Б. Культивирование Bordetella bronchiseptica на различных селективных средах / Ю.Б. Никульшина, Д.Г. Сверкалова, А.В. Мастиленко, Д.Н. Хлынов, Д.А. Васильев // Актуальные вопросы аграрной науки и обраАктуальные проблемы инфекционной патологии и биотехнологии зования Материалы Международной научно-практической конференции, посвященной 65-летию Ульяновской ГСХА. Ульяновск - 2008. - С. 57-59.

4. Васильев Д.А. Индикация Bordetella bronchiseptica из объектов внешней среды и клинических образцов / Д.А. Васильев, Ю.Б. Васильева, Е.Н. Семанина, Е.Г. Семанин // Аграрная наука и образование на современном этапе развития: опыт, проблемы и пути их решения Материалы V Международной научно-практической конференции. Ульяновск: ГСХА им. П.А. Столыпина. -2013. - С. 18-22.

5. Васильев Д.А. Бордетеллёз животных: характеристика заболевания и возбудителя, разработка методов диагностики / Д.А. Васильев, Ю.Б. Васильева, А.В. Мастиленко, Д.Г. Сверкалова, Е.Н. Семанина, О.Ю. Борисова, С.Н. Золотухин, И.Г. Шведенко. Ульяновск: Ульяновская ГСХА им. П.А. Столыпина, 2014. – 206 с.

6. Никульшина Ю.Б. Разработка методов индикации и идентификации Bordetella bronchiseptica, выделенных у домашних животных / Ю.Б. Никульшина, Д.Г. Сверкалова, Е.Н. Никулина // Ветеринарная патология. 2007. - № 4. - С. 103-106.

7. Потатуркина-Нестерова Н.И. Атомно-силовая микроскопия как метод исследования в микробиологии / Н.И. Потатуркина-Нестерова, И.С. Немова, А.В.

Даньшина // Современные проблемы науки и образования. - 2012. - № 3.

- С. 316.

8. Елистратова Л.Л. Современное состояние проблемы демодекоза / Л.Л.

Елистратова, Н.И. Потатуркина-Нестерова, А.С. Нестеров // Фундаментальные исследования. - 2011. - № 9-1. - С. 67-69.13.

9. Потатуркина-Нестерова Н.И. Изменение вирулентных свойств урогенитальных энтерококков в условиях межмикробных взаимоотношений / Н.И.

Потатуркина-Нестерова, И.С. Немова, М.Н. Артамонова, Е.Б. Хромова, О.Е.

Хохлова, Н.В. Трофимова, О.В. Теплякова, И.А. Кочергина // Современные проблемы науки и образования. - 2013. - № 1. - С. 8.

10. Белозерова Е.А. Влияние хронического поступления солей меди, цинка и свинца на микробиологический баланс толстой кишки в условиях эксперимента / Е.А. Белозерова, Н.И. Потатуркина-Нестерова, Е.С. Климов. -Токсикологический вестник. - 2007. - № 4. - С. 26-30.

11. Яцишина С.Б. Применение мультиплексной ПЦР для идентификации вирулентных форм возбудителя сибирской язвы / С.Б. Яцишина, И.Л. Обухов, Л.С. Саленко, Б.И. Шморгун и др. // Сб. тезисов Генодиагностика инфекционных заболеваний. Всеросс. науч.-практич. Конференция. – 2002.

–  –  –

Key words: PCR, molecular genetic indelicacy, C. ulcerans, C. diphtheria Summary. The article discusses the development of molecular geneticheskoi identification of C. ulcerans-based PCR method in “real time”. As a result of the experiments, we have found that oligonucleotides and fluorescent probe dye R6G flanking fragment of the uvrB gene UvrABC system protein B are species-specific for C. ulcerans.

УДК 616.99+619:616.99

БАКТЕРИИ РОДА HELICOBACTER У БЕЛЫХ

МЫШЕЙ И КРЫС

Луконина А.А., Савельева А.В., студенты 3 курса факультета ветеринарной медицины Научный руководитель – Нургалиев Ф.М., кандидат ветеринарных наук, доцент

–  –  –

Ключевые слова: бактерии рода Helicobacter, хеликобактериоз, крысы, мыши.

Аннотация. Работа посвящена изучению распространения бактерий рода Helicobacter среди белых мышей и крыс, выявление связи этих микроорганизмов с патологическими изменениями в организме исследуемых животных.

Бактерии рода Helicobacter были открыты в 1983 году Б. Маршаллом и Р.

Уорреном, в 2005 году эти ученые получили Нобелевскую премию в области физиологии и медицины за открытие влияния бактерии данного рода на развитие гастрита, язвы и рака желудка у человека [1]. Открытым остается вопрос, связанный с механизмом заражения хеликобактерами: большинство исследователей считают, что основными источниками заражения являются больной чеАктуальные проблемы инфекционной патологии и биотехнологии ловек или бактерионоситель. Имеются сообщения, что Helicobacter pylori могут переносить домашние животные (кошки, мыши, хомяки, собаки), однако, в ветеринарии это заболевание изучено недостаточно [2,3,4].

Целью нашей научной работы явилось изучение распространения бактерий рода Helicobacter среди крыс и белых мышей, выявление связи этих микробов с патологическими изменениями в организме исследуемых животных.

В ходе наших исследований были изучены биоматериалы 20 лабораторных мышей и 50 белых крыс. Мы определяли патологоанатомические изменения у лабораторных животных путем проведения вскрытие и описание изменений в органах. Для постановки лабораторного диагноза проводили микроскопические, бактериологические, биохимические методы исследований. Произведено определение наличия обсемененности слизистой оболочки желудка бактериями рода Helicobacter. Биоматериал из пилорической части желудка помещался в пробирки с готовым раствором для минутного теста на определение фермента уреазы.

Для выделения бактерии рода Helicobacter из биоматериала, исходя из литературных данных, нами была приготовлена селективная питательная среда: к мясопептонному агару добавили 10 % дефибринированной крови барана, ванкомицин в концентрации 10 мг/л, полимиксин – 2500 МЕ/л, амфотерицин 5 мг/л [3].

При вскрытии белых мышей у 3 печень была увеличена в размере, желто-коричневого цвета, края закруглены, дряблой консистенции. У 7 (35 %) голов наблюдались отек, умеренная гиперемия, разрыхление слизистой оболочки, эрозии в антральном, а иногда в фундальном отделе желудка. В двенадцатиперстной кишке наблюдали признаки хронического катарального энтерита. В кишечном содержимом отмечали большое количество густой, мутноватой слизи.

При вскрытии крыс были обнаружены патологоанатомические изменения в печени у 9 (4,5 %) животных, относительно других она была увеличена в размере, желто-коричневого цвета, дряблая. В 13 (26 %) случаях наблюдались: отек, умеренная гиперемия, разрыхление слизистой оболочки, эрозии в желудке.

Изготовленные мазки-отпечатки со слизистой оболочки пилорического отдела желудка животных высушивали на воздухе и фиксировали метанолом. После чего окрашивали мазки по Граму, по Романовскому-Гимзе. Определяли подвижность методом «раздавленной капли». Далее стали просматривать наши мазки через световой микроскоп и обнаружили среди окрашенной слизи более ярко окрашенные спиралевидные и изогнутые палочки, являющиеся грамотрицательными и имеющие диаметр от 0,2 до 0,8 мкм и длину от 2 до 5 мкм. Методом «раздавленной капли» в препаратах взятых от мышей были обнаружены подвижные извитые спиралевидные бактерии, а от крыс – шаровидные, неподвижные.

Результаты биохимических исследований и выделения бактерий представлены в таблице №1.

Исследования в области микробиологии и вирусологии

–  –  –

Как видно из таблицы, 45% проб от белых мышей и 38% от белых крыс, дали положительную реакцию в уреазной пробе. Обнаружение фермента уреаза, говорит о наличии бактерий рода Helicobacter, ведь никакая другая бактерия не может продуцировать уреазу в условиях желука в таких количествах, что она накапливалась в слизистой оболочке. На пятые сутки роста бактерий появились мелкие (диаметром 0,5-1,0 мкм) круглые, прозрачные, выпуклые, влажные колонии, в 10% случаев выделенных от белых мышей и в 26% случаев выделенных от белых крыс.

Проведенная комплексная лабораторная диагностика биоптатов желудка у белых мышей и крыс позволила диагностировать наличие бактерий рода Helicobacter микроскопией и биохимическим методом, а так же в ряде случаев выделить эти микробы. Практически во всех случаях, где был взят материал от животных с патологоанатомическими изменениями в желудке, двенадцатиперстной кишке и печени, мы диагностировали хеликобактериоз, что косвенно подтверждает этиологическую роль бактерии рода Helicobacter в этих заболеваниях. Данные этого исследования дают дополнительную информацию о циркулировании бактерий рода Helicobacter среди домашних животных.

Библиографический список:

1. Бактерии рода Helicobacter у животных / Ф.М. Нургалиев [и др.] // Учёные записки КГАВМ. – 2012. – Т 211. – С. 121-125.

2. Исаков В.А. Хеликобактериоз / В.А. Исаков, И.В. Домарадский. – М.: ИД Медпрактика-М, 2003 г., 412 с.

3. Исаева Г.Ш. Резистентность Helicobacter pylori к антибактериальным препаратам и методы ее определения. /Исаева Г.Ш. // Клиническая микробиология и антимикробная химиотерапия. – 2010. - №1. – С.57-66.

4. Луконина А.А., Выделение бактерии рода Helicobacter от свиней. / Луконина А.А., Савельева А.В., Чернова Т.С// Актуальные вопросы ветеринарии и зоАктуальные проблемы инфекционной патологии и биотехнологии отехнии, материалы научно-практической конференции (тезисы докладов).

- Казань: ЧПИ КГАВМ, 2013. – т. 67. – С. 59-62.

–  –  –

Key words: bacteria of Helicobacter genus, Helicobacter pylori infection, mice, rats Summary. Conducting laboratory diagnosis complex of gastric biopsies from white mice and rats allows to diagnose bacteria of Helicobacter genus by laboratory methods.

УДК 636.5:579.843.95(571.54)

КЛИНИКО-МОРФОЛОГИЧЕСКАЯ

И МИКРОБИОЛОГИЧЕСКАЯ ХАРАКТЕРИСТИКА

ПАСТЕРЕЛЛЕЗА У ДЕКОРАТИВНЫХ ПТИЦ

В Г. УЛАН-УДЭ Орешкин А.В., студент 4 курса факультета ветеринарной медицины Научный руководитель – Ханхасыков С.П., доктор ветеринарных наук, доцент

–  –  –

Ключевые слова: пастереллез, декоративная птица, клиника, патоморфология, микробиология.

Аннотация. В представленной статье рассматривается частный случай заболевания и падежа 2 попугаев, находящихся на содержании у частных лиц. Приводятся данные клинического, патологоанатомического и микробиологического исследований.

Декоративное птицеводство в условиях г. Улан-Удэ находит все большее распространение. Вместе с этим, чаще возникают проблемы диагностики и лечения их заболеваний.

Исследования в области микробиологии и вирусологии Содержание птиц клеточное. В рацион входила стандартная кормовая смесь, тертые фрукты и овощи, листья салата, сухари. Вода вволю.

У обеих птиц в течение 7 – 10 дней наблюдали понос, прогрессирующую вялость, угнетенное состояние, жажду. Аппетит сохранен. В последние 3 дня болезни состояние резко ухудшилось, смерть наступила с клиническими признаками истощения и обезвоживания.

При вскрытии обнаружено: истощение, дегидратация, отек легких, точечные кровоизлияния на серозных и слизистых оболочках кишечника, точечные и пятнистые кровоизлияния на эпикарде. Печень и почки в состоянии белковой дистрофии, селезенка депонированная, суставы воспалены. В трахее – значительное количество слизи серовато-белого цвета. В подкожной клетчатке отмечаются разлитые серозно-фибринозные инфильтраты.

Из кусочков сердца, печени, кишечника, лёгких, слизи из трахеи изготовлены мазки-отпечатки, окрашены по Граму, синькой Лёфлера и исследованы на наличие возбудителя на микроскопе Микрон 200М.

В мазках-отпечатках, окрашенных по Граму, выявлены грамотрицательные короткие овоидные палочки, при окраске синькой Леффлера имевшие вид биполяров (интенсивно окрашивались по полюсам).

Были произведены посевы на питательные среды: МПА, МПБ, а так же на МПБ и МПА с добавлением сыворотки крови барана. В термостате, при температуре 370С, спустя 24 часа на МПА выросли мелкие, шероховатые, непрозрачные, округлой формы колонии. На МПБ отмечено равномерное помутнение среды и образование на дне пробирки хлопьевидного осадка, поднимающегося при встряхивании в виде косички.

Культура ферментирует глюкозу, образует индол, не разжижает желатин, гемолиза на кровяном агаре не вызывает, проба на каталазу положительная.

В мазках из культур имеют вид коккоовоидных палочек, располагающихся одиночно, попарно, реже в виде цепочек. Палочки неподвижные, образуют слизистые капсулы, спор не образуют.

Для определения вирулентности возбудителя поставлена биопроба (подкожное заражение белой мыши). Спустя 36 часов наступила гибель животного.

При вскрытии взят патологический материал (сердце, печень, кишечник, лёгкие), из которого изготовлены мазки-отпечатки и произведены посевы на питательные среды по общепринятой методике [1].

Микробиологическая картина выделенной культуры (рис.2) соответствует возбудителю Pasteurella multocida.

Таким образом, по результатам микробиологического исследования с учетом клинической картины и данных патологоанатомического исследования нами поставлен окончательный диагноз – пастереллез птиц.

–  –  –

1. Костенко, Т.С., Скаршевская, Е.И. Практикум по ветеринарной микробиологии и иммунологии / Т.С. Костенко, Е.И. Скаршевская, С.С. Гительсон. – М.:

Агропромиздат, 1989. – 272 с.

–  –  –

Key words: pasteurellosis, decorative bird, clinic, pathomorphology, microbiology.

Summary. In the present article considers a special case of the diseases and deaths of 2 parrots that are kept by private individuals. presents results of clinical, pathological and microbiological studies.

–  –  –

УДК 579.63

БАКТЕРИОЛОГИЧЕСКОЕ ИССЛЕДОВАНИЕ

ОХЛАЖДЕННОЙ РЫБЫ

Панцырева Е.С., Бурова Н.С., студенты 4 курса факультета ветеринарной медицины Научные руководители – Сульдина Е.В., аспирант; Васильев Д.А., доктор биологических наук, профессор

–  –  –

Ключевые слова: охлажденная рыба, бактериология, бактериологическое исследование, БГКП, стафилококки.

Аннотация. Работа посвящена проведению бактериологического исследования охлажденной рыбы и определению ее общего микробного числа. При проведении бактериологии на основании роста микроорганизмов на питательных средах и окраски мазков по Грамму нами были выявлено присутствие в рыбе бактерии группы кишечной палочки и стафилококков.

Рыбное хозяйство нашей страны всегда играло важную роль в обеспечении населения основными продуктами питания. В рыбе и рыбопродуктах представлены все необходимые аминокислоты в оптимально сбалансированных количествах, а также полиненасыщенные жирные кислоты, незаменимые для жизнедеятельности человека. Однако в ряде случаев рыба и морепродукты являются источником заражения человека, домашних и диких плотоядных животных [3-7].

Целью наших исследований стало проведение бактериологического исследования охлажденной рыбы и определение ее общей микробной обсемененности.

Исследования проводились на кафедре микробиологии, вирусологии, эпизоотологии и ветеринарно-санитарной экспертизы ФГБОУ ВПО «Ульяновская ГСХА им. П.А. Столыпина».

Для исследования было взято 3 пробы охлажденной рыбы, приобретенные в крупных сетевых магазинах Ульяновской области. Рыба была взята с соблюдением правил отбора проб [2].

Исследования проводились по общепринятым микробиологическим методам [1].

Результат исследований. С помощью обезжиренного стерильного предметного стекла сделали отпечатки с поверхности и внутренней части исследуемых проб. Мазки-отпечатки, окрашивали по Грамму и микроскопировали.

На поверхности пробы №1 обнаружили единичные G+ кокки, в глубоких слоях исследуемого материала микроорганизмов в 5 полях зрения не обнаружили.

Актуальные проблемы инфекционной патологии и биотехнологии В пробах №2 и 3 ничего не обнаружено.

Для определения общего микробного числа сделали разведение каждой пробы: 1/10, 1/100, 1/1000. По 1 мл из разведений добавили в расплавленный, остуженный до 45-50 °С агар и перелили на чашки Петри, инкубировали 24 ч при t 37°С. Описали выросшие колонии, подсчитали общее микробное число, с разных типов колоний сделали мазки и покрасили по Граму (табл.1).

–  –  –

Подсчитали выросшие в толще и на поверхности МПА колонии. Для получения микробного числа количество выросших колоний в каждой чашке Петри умножили на соответствующее разведение рыбы, полученные результаты сложили и разделили на количество чашек.

Исследования в области микробиологии и вирусологии

Общее микробное число:

1 проба: 1:10 = 0; 1:100 = 135; 1:1000 = 39 итого: 274,6 кое/мл 2 проба: 1:10 = 31; 1:100 = 3; 1:1000 = 4 итого: 12,6 кое/мл 3 проба: 1:10 = 35; 1:100 = 4; 1:1000 = 3 итого: 12,5 кое/мл Для определения родовой принадлежности и частичной идентификации микроорганизмов были сделаны посевы на среды:

• Эндо (определение наличия БГКП)

• желточно-солевой агар – ЖСА (определение наличия стафилококка)

• газоном на МПА с разведения 10-5 (наблюдение за общей картиной наличия микроорганизмов в пробирке)

• висмут – сульфит агар – ВСА (обнаружение сальмонелл)

• среда Кесслера (определение бактерий группы кишечных палочек) Чашки с посевами поместили в термостат и культивировали 24 часа при температуре 37С.

–  –  –

Актуальные проблемы инфекционной патологии и биотехнологии Таким образом, при проведении бактериологического исследования охлажденной рыбы на основании роста микроорганизмов на питательных средах и окраски мазков по Грамму нами были выявлено присутствие бактерии группы кишечной палочки и стафилококков.

–  –  –

1. Методические указания МУК 4.2.2884-11. Методы микробиологического контроля объектов окружающей среды и пищевых продуктов. М.: ФЦ Роспотребнадзора. 2011.- 24 с.

2. ГОСТ 7631-73. Рыба, продукты из рыбы, морские млекопитающие и беспозвоночные. Правила приемки. Методы органолептической оценки качества. Методы отбора проб для лабораторных испытаний.

3. Разработка системы фаготипирования листерий / Е.Н. Ковалева, Д.А. Васильев, Е.В. Сульдина // Инфекция и иммунитет. – 2014. – сентябрь, специальный выпуск – С. 87-88.

4. Выделение бактериофагов бактерий рода Listeria / Д.А. Васильев, Е.Н. Ковалева, Е.В. Сульдина // Инфекция и иммунитет. – 2014. – сентябрь, специальный выпуск – С. 69-70.

5. Основные биологические свойства листериозных бактериофагов / Е.В.

Сульдина, Д.А. Васильев, Е.Н. Ковалева // Материалы VI Международной научно-практической конференции «Аграрная наука и образование на современном этапе развития: опыт, проблемы и пути их решения». Часть III / Ульяновск, ГСХА им. П.А.Столыпина. - 2015. – С.125-127.

6. Фаготипирование листерий / Е.В. Сульдина, Е.Н. Ковалева, Д.А. Васильев // Материалы Всероссийского симпозиума с международным участием «Современные проблемы физиологии, экологии и биотехнологии микроорганизмов». Москва, МГУ имени М.В. Ломоносова. Биологический факультет.

– М.: МАКС Пресс. - 2014. – С.223

7. Васильев, Д.А. Разработка параметров количественного определения бактерий видов Listeria monocytogenes и Listeria ivanovii на основе мультиплексной пцр в режиме «реального времени» / Д.А. Васильев, Е.Н. Ковалева, Е.В.

Сульдина, А.В. Мастиленко // Материалы Международной научно-практической конференции, посвященной 55-летию ВНИИВВиМ «Актуальные вопросы контроля инфекционных болезней животных». Покров. - 2014. - С.

91-96.

8. Сульдина Е.В. Применение метода молекулярно-генетического анализа для видовой идентификации мяса / Е.В. Сульдина, О.Л. Колбасова, С.В. Мерчина // Актуальные проблемы инфекционной патологии и биотехнологии МатеИсследования в области микробиологии и вирусологии риалы V-й Всероссийской (с международным участием) студенческой научной конференции. Ульяновск. - 2012. - С. 227-231.

9. Сульдина Е.В. Применение метода Real-time PCR для видовой идентификации мясного сырья в мелкоизмельченных полуфабрикатах и готовых мясных продуктах / Е.В. Сульдина, О.Л. Колбасова, С.В. Мерчина // Актуальные проблемы инфекционной патологии и биотехнологии Материалы V-й Всероссийской (с международным участием) студенческой научной конференции. Ульяновск. - 2012. - С. 236-240.



Pages:   || 2 | 3 | 4 | 5 |



Похожие работы:

«Научный журнал НИУ ИТМО. Серия «Экономика и экологический менеджмент» № 4, 2014 УДК 37.043; 316.454.3; 338.24.01 История групповых форм обучения и развитие образования в информационном обществе Канд. пед. наук Дмитренко Н. А....»

«Ганшин Владимир Михайлович, кандидат технических наук Чебышев Александр Васильевич, кандидат химических наук Фесенко Анатолий Владимирович, доктор технических наук КОМПЛЕКСНЫЕ СИСТЕМЫ МОНИТОРИНГА ТОКСИКОЛОГИЧЕСКОЙ И ЭКОЛОГИЧЕСКОЙ БЕЗОПАСНОС...»

«Всесибирская олимпиада по биологии. 2012-13. Заключительный этап. 7-8 кл. Стр. 1 из 2 14. Насекомые с НЕполным превращением – это Всесибирская олимпиада по А. муравьи В. термиты биологии 2012-13 Б. пчелы Г. все перечислен...»

«РЯБОВ ВЯЧЕСЛАВ АЛЕКСАНДРОВИЧ АКУСТИЧЕСКИЕ СИГНАЛЫ, СЛУХ И ЭХОЛОКАЦИОННАЯ СИСТЕМА ДЕЛЬФИНА 03.01.02 биофизика Диссертация на соискание ученой степени доктора физико-математических наук Научный консультант: д.б.н., профессор Токарев Юрий Николаевич С-Петербург 2016   ОГЛАВЛЕНИЕ Стр. ВВЕ...»

«Экономика и экологический менеджмент №4, 2013 УДК 336.64 Инструменты финансирование компаний малого и среднего бизнеса Д-р экон. наук Сергеева И.Г. irsergeeva@mail.ru Санкт-Петербургский национальный исследовательский университет ИТМО Институт холода и биотехнологий 191002, Санкт-Петербург, ул. Ломоносова, 9 В статье рассматривается...»

«Труды БГУ 2011, том 6, часть 2 Молекулярная биология УДК 604.6:635.21 МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ ТРАНСГЕННЫХ РАСТЕНИЙ КАРТОФЕЛЯ С ГЕНОМ GOX PENICILLIUM FUNICULOSUM Д.В. Савчин, А.С. Панюш, Н.А. Картель ГНУ «Институт...»

««Вятка – территория экологии» Департамент экологии и природопользования Кировской области ФГБОУ ВПО «Вятский государственный гуманитарный университет» Серия тематических сборников и DVD-дисков «Экологическая мозаика» Сборник 4 ОТХОДЫ ПРОИЗВОДСТВА И ПОТРЕБЛЕНИЯ Учебно -методическое пособие Киров УДК 502 ББК 28.08...»

«Виноградов Александр Евгеньевич Функциональное значение базовых свойств структуры генома эукариот 03.01.03 молекулярная биология Автореферат диссертации на соискание ученой степени доктора биологических наук Санкт-Петербург Работа выполнена в Учреждении Российской академии наук Институт цитологии РАН (Санкт-Петербург). Официальные оппоненты: доктор би...»

«НАУМОВ Юрий Анатольевич АНТРОПОГЕННАЯ ТРАНСФОРМАЦИЯ ПРИБРЕЖНО-ШЕЛЬФОВЫХ ГЕОСИСТЕМ ОКРАИННЫХ МОРЕЙ ДАЛЬНЕГО ВОСТОКА РОССИИ 25.00.36 – Геоэкология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора географических наук Томск 2008 Работа выполнена на кафедре экологии и природопользования Владивостокского государствен...»

«ИНФОРМАЦИЯ о квалификации и опыте работы лиц, занимающих должности Председателя Правления, его Заместителей, членов Правления, Главного бухгалтера, Заместителей Главного бухгалтера ООО МИБ «ДАЛЕНА» Безрукова Наталья Должность: Врио Председателя Правления 1. Викт...»

«ПРОФЕССИОНАЛЬНАЯ КОСМЕЦЕВТИКА В конце 80-годов французский биохимик, известный ученый в косметологии доктор Александр Дингас основал на юге Франции (всемирном исследовательском центре) косметическую лабораторию SOSKIN. Воодушевленный передовыми открытиями в клеточной биологии и имея в своем арсенале чистейшие природны...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ ФГБОУ ВО Новосибирский национальный исследовательский государственный университет Факультет естественных наук УТВЕРЖДАЮ Декан ФЕН НГУ, профессор _ Резников В.А. «» 2013 г. Рабочая программа дисциплины Экологическая...»

«МИНИСТЕРСТВО ПРИРОДНЫХ РЕСУРСОВ и экологии РОССИЙСКОЙ ФЕДЕРАЦИИ (Минприроды России) ПРИКАЗ МОСКВА г. 30.03.2015 № 171-л с О награждении За многолетний добросовестный труд, большой вклад в развитие минерально-сырьевой базы России и в связи с проф...»

«ФЕДЕРАЛЬНОЕ АГЕНТСТВО ПО ОБРАЗОВАНИЮ СИБИРСКОЕ ОТДЕЛЕНИЕ РОССИЙСКОЙ АКАДЕМИИ НАУК АДМИНИСТРАЦИЯ НОВОСИБИРСКОЙ ОБЛАСТИ КОМИССИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ ПО ДЕЛАМ ЮНЕСКО НОВОСИБИРСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ МАТЕРИАЛЫ XLVII МЕЖДУНАРОДНОЙ НАУЧНОЙ СТУДЕНЧЕСКОЙ...»

«БУДАНОВА Мария Геннадьевна ФЛОРА СОСУДИСТЫХ РАСТЕНИЙ ГОРОДА ОМСКА 03.00.05 Ботаника Автореферат диссертации на соискание ученой степени кандидата биологических наук Томск – 2003 Работа выполнена на кафедре ботаники Томского государственного университ...»

«Составители: И.О.Ф Н.Г. Бабкина Ученая степень кбн Ученое звание доцент Должность доцент Рецензенты: И.О.Ф В.Н Дармограй В.И.Звягина Ученая степень д.ф.н. к.б.н. Ученое звание профессор доцент Должность зав.каф доцент Рабочая программа дисциплины «Биология» оформлена и структур...»

«ИССЛЕДОВАНИЕ РЕЦЕПТУРЫ БИСКВИТНОГО ПЕЧЕНЬЯ ДЛЯ БОЛЬНЫХ САХАРНЫМ ДИАБЕТОМ Л. К. Джанкулиева, Л. Е. Мелшкина ФГБОУ ВПО «Алтайский государственный технический университет им. И.И. Ползунова», г....»

«Трудоемкость 1 зачетная единица (36 часов) Введение В основу настоящей программы положены следующие разделы: почва и ее свойства; типы почв и их систематика. Программа разработана экспертным советом Высшей аттестац...»

«Министерство здравоохранения и социального развития РФ ГОУ ВПО ИГМУ Кафедра фармакогнозии с курсом ботаники Методические указания для студентов 3 курса фармацевтического факультета Тема: Растения и сырье, содержащие жирные масла и различные группы биологически активных веществ Иркутск 2009 С...»

«1992 г. В.О. РУКАВИШНИКОВ ФАКТОРНАЯ МОДЕЛЬ СТРУКТУРЫ ОБЩЕСТВЕННОГО МНЕНИЯ И ПРОБЛЕМЫ ЭКОЛОГИИ В СОВРЕМЕННОЙ РОССИИ РУКАВИШНИКОВ Владимир Олегович — доктор философских наук, заместитель директора Института социально-политических исследований (ИСПИ) РАН. Наш постоянный...»

«КОМПЬЮТЕРНЫЕ ИССЛЕДОВАНИЯ И МОДЕЛИРОВАНИЕ 2013 Т. 5 № 5 С. 813–820 МОДЕЛИ В ФИЗИКЕ И ТЕХНОЛОГИИ УДК: 544.2 Моделирование свойств жидких гептана и циклогексана Д. В. Зленко1,a, С. В. Стовбун2 МГУ имени М. В. Ломоносова, биологическ...»

«В.Г. Беспалов, В.Б. Некрасова, И.А. Шевченко, А.С. Вершинин Провитам – биоактивный комплекс из хвои сосны и ели Санкт-Петербург Аннотация Беспалов В.Г., Некрасова В.Б.,...»







 
2017 www.pdf.knigi-x.ru - «Бесплатная электронная библиотека - разные матриалы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.