WWW.PDF.KNIGI-X.RU
БЕСПЛАТНАЯ  ИНТЕРНЕТ  БИБЛИОТЕКА - Разные материалы
 

Pages:   || 2 | 3 |

«OTYET 0 BbIIIOJIHEHl?U!l TEMATMZIECKOI'O IIJIAHA HAYYHO-MCCJIEAOBATEJIbCKkIXPAEOT IIO 3AICA3Y MnHCEJIbX03A POCCHH k 3 CPEACTB QEAEPAJIbHOTO EIOAXETA 2011 r O A OTYET ...»

-- [ Страница 1 ] --

PACCMOTPEH

OTYET

0 BbIIIOJIHEHl?U!l TEMATMZIECKOI'O IIJIAHA

HAYYHO-MCCJIEAOBATEJIbCKkIXPAEOT

IIO 3AICA3Y MnHCEJIbX03A POCCHH

k 3 CPEACTB QEAEPAJIbHOTO EIOAXETA

2011 r O A

OTYET IIPMHAT:

3 a ~ e c ~ m e a u p e ~ ~ A e na a y. r ~ e x n o n a ~ a ~ a

nb o~ ~

Mk~~cenbxosa C C H ~

PO

B.E. Eepab~rue~ 2011 r.

(( ))

СОДЕРЖАНИЕ

СОДЕРЖАНИЕ

СПИСОК ИСПОЛНИТЕЛЕЙ ПО РАЗДЕЛАМ (темам)

РЕФЕРАТ

1 РАЗРАБОТКА ЭКОЛОГИЧЕСКИ БЕЗОПАСНЫХ,

РЕСУРСОСБЕРЕГАЮЩИХ ТЕХНОЛОГИЙ ВОЗДЕЛЫВАНИЯ ПОЛЕВЫХ

КУЛЬТУР НА ОСНОВЕ ИНТРОДУКЦИИ, МИНИМАЛИЗАЦИИ ОБРАБОТКИ

ПОЧВЫ, СОВЕРШЕНСТВОВАНИЯ СЕВООБОРОТОВ И

ВОСПРОИЗВОДСТВА ПЛОДОРОДИЯ ДЕРНОВО-ПОДЗОЛИСТЫХ ПОЧВЫ

ВЕРХНЕГО ПОВОЛЖЬЯ

1.1 Введение

1.2 Современное состояние изучаемого вопроса

1.2.1 Принципы и способы перехода от традиционного земледелия к ресурсосберегающим технологиям

1.2.2 Современные подходы к ресурсосберегающим технологиям.... 16

1.3 Роль ресурсосберегающих технологий возделывания полевых культур с использованием минимальных приемов обработки почвы19 1.3.1 Цели и задачи исследований



1.3.2 Условия научно-исследовательской работы и методика исследований

1.3.4 Результаты исследований роли ресурсосберегающих технологий возделывания полевых культур с использованием минимальных приемов обработки почвы

1.3.4.1 Метеорологические условия

1.3.4.2 Влияние приемов обработки на плотность и пористость почвы

1.3.4.3 Изменение влажности почвы в зависимости от приемов обработки почвы

1.3.4.4 Видовой состав и численность сорных растений в агроценозе

1.3.4.5 Микробиологическая активность почвы

1.3.4.6 Биологическая урожайность и элементы её структуры.... 39 1.3.4.7 Экономическая оценка результата применения элементов ресурсосберегающей технологии

1.4 Интродукция сои как фактор повышения уровня интенсификации отрасли растениеводства (на примере условий Костромской области)

1.4.1 Характеристика почвенного участка для проведения исследований, объекты и схема исследования

1.4.2 Результаты исследований интродукции сои в условиях Костромской области

1.4.2.1 Продолжительность вегетационного периода и фаз роста и развития сои

1.4.2.2 Формирование габитуса растений сои

1.4.2.3 Показатели фотосинтетической деятельности растений 51 1.4.2.4 Биологическая урожайность и элементы её структуры.... 52 1.4.2.5 Экономическая оценка результата

1.5 Рекомендации производству

2 АНАЛИЗ ГЕНОФОНДА КОСТРОМСКОЙ ПОРОДЫ КРУПНОГО

РОГАТОГО СКОТА С ИСПОЛЬЗОВАНИЕМ ДНК-МАРКЕРОВ ПО

ГЕНАМ, ОТВЕТСТВЕННЫМ ЗА РОСТ, КАЧЕСТВО МОЛОКА И

УСТОЙЧИВОСТЬ К ЗАБОЛЕВАНИЯМ

2.1 Введение

2.2 Обзор литературы

2.3 Материалы и методы

2.4 Результаты и их обсуждение

3 РАЗРАБОТКА И ИССЛЕДОВАНИЕ АВТОМАТИЗИРОВАННОЙ





СИСТЕМЫ УПРАВЛЕНИЯ ТЕХНОЛОГИЧЕСКИМ ПРОЦЕССОМ

ПОДРАБОТКИ ЗЕРНОВЫХ КОЛОСОВЫХ КУЛЬТУР МЕТОДОМ

ТЕРМОДИНАМИЧЕСКОГО ВОЗДЕЙСТВИЯ

3.1 Автоматизированные и автоматические системы управления технологическим процессом

3.2 Обзор существующих систем управления технологическим процессом сушки зерновых колосовых культур

3.3 Особенности автоматизации процесса сушки зерна методом термодинамического воздействия

3.3.1 Регулирование процессов сушилок термодинамического воздействия

3.3.2 Регулирование отдельных параметров

3.4 Классификация датчиков и основные требования к ним............. 111

3.5 Разработка экспресс-метода определения структуры зернового слоя

4 РАЗРАБОТКА И ИЗГОТОВЛЕНИЕ МАКЕТНОГО ОБРАЗЦА

УСОВЕРШЕНСТВОВАННОГО РЕСУРСОСБЕРЕГАЮЩЕГО

АППАРАТА ДЛЯ ОТДЕЛЕНИЯ СЕМЕННОЙ ЧАСТИ УРОЖАЯ ОТ

СТЕБЛЕЙ ПРИ РАЗДЕЛЬНОЙ УБОРКЕ ЛЬНА

Введение

4.1 Обоснование необходимости проведения НИР

4.2 Анализ известных аппаратов для отделения семенной части урожая от стеблей льна-долгунца

4.3 Разработка технологической схемы усовершенствованного ресурсосберегающего плющильно-очесывающего аппарата для льна

4.4 Разработка конструкции и изготовление макетного образца усовершенствованного плющильно-очесывающего аппарата........ 160

5 РАЗРАБОТКА МЕТОДИЧЕСКИХ РЕКОМЕНДАЦИЙ ПО

ПРИМЕНЕНИЮ НАУЧНО-ОБОСНОВАННЫХ НОРМАТИВОВ

ПОТРЕБНОСТИ В ТЕХНИКЕ, ТОПЛИВЕ И РАБОЧЕЙ СИЛЕ ДЛЯ

РАСТЕНИЕВОДСТВА НА ОСНОВЕ КОМПЬЮТЕРНОГО

МОДЕЛИРОВАНИЯ МАШИНОИСПОЛЬЗОВАНИЯ

5.1 Введение

5.2 Общие сведения о нормативах

5.3 Методика компьютерного моделирования

5.4 Средства оценки и сравнения вариантов использования МТП.. 177

5.5 Варианты использования компьютерной программы................. 180

5.6 Краткое описание компьютерной программы «Машиннотракторный парк» версии 2011

5.6.1 Ввод исходных данных

5.6.2 Контроль ошибок

5.6.3 Просмотр результатов

5.7 Методика применения программы для работы с нормативами.. 202 5.7.1 Оценка последствий использования конкретных нормативов 203 5.7.2 Уточнение значений нормативов в определенных условиях.. 205 5.7.3 Разработка (выведение, обоснование) новых нормативов....... 212 5.7.4 Получение нормативов из справочников

ЗАКЛЮЧЕНИЕ

СПИСОК ИСПОЛЬЗОВАННЫХ ЛИТЕРАТУРНЫХ ИСТОЧНИКОВ.. 222

Выписка из протокола заседания Научно-технического совета ФГБОУ ВПО Костромская ГСХА от 29.12.2011 г. 240 СПИСОК ИСПОЛНИТЕЛЕЙ ПО РАЗДЕЛАМ (темам)

–  –  –

РЕФЕРАТ

Научно-технический отчет, включающий 5 разделов в соответствии с тематическим планом НИР по заказу Минсельхоза России на 2011 год, изложен на 240 стр. содержит 24 таблицы, 72 рисунка, 165 литературных источников.

Краткая характеристика НИР по разделам (темам) Раздел 1. Разработка экологически безопасных, ресурсосберегающих технологий возделывания полевых культур на основе интродукции, минимализации обработки почвы, совершенствования севооборотов и воспроизводства плодородия дерново-подзолистых почвы Верхнего Поволжья Ключевые слова: РЕСУРСОСБЕРЕГАЮЩИЕ ТЕХНОЛОГИИ,

ОЗИМЫЕ ЗЕРНОВЫЕ КУЛЬТУРЫ, СОЯ, ИНТРОДУКЦИЯ, СОРТА,

АДАПТИВНОСТЬ, УРОЖАЙНОСТЬ.

Целью работы является разработка и внедрение ресурсосберегающих технологий возделывания озимых зерновых культур и сортов сои северного экотипа с применением комплекса машин в производственных условиях Костромской области.

В течение 2011 года проведены наблюдения за изменением физикомеханических свойств почвы, её микробиологической активностью, реакцией изучаемых культур и сорных растений на применение минимальной обработки почвы в сравнении с традиционной обработкой (отвальной вспашкой).

Снижение интенсивности обработки почвы повышает накопление органического вещества, улучшает процессы гумификации, физические свойства почвы.

Комплексные изменения в системе обработки почвы сформировали условия повышения урожайности озимой тритикале на 0,7 т/га. Подбор адаптивных сортов сои позволяет получить в условиях Костромской области урожайность в пределах 1,1-3,4 т/га.

Применение минимальной обработки почвы позволило снизить себестоимость полученной продукции по сравнению со вспашкой на 9,41 руб./ц.

Раздел 2. Анализ генофонда костромской породы крупного рогатого скота с использованием ДНК-маркеров по генам, ответственным за рост, качество молока и устойчивость к заболеваниям Ключевые слова: КОМПЛЕКСНОЕ ИССЛЕДОВАНИЕ СТАД,

ГЕНЫ КАППА КАЗЕИНА, ГОРМОНА РОСТА И ПРОЛАКТИНА, МЕТОД

ПЦР-ПДРФ, ЧАСТОТЫ АЛЛЕЛЕЙ И ГЕНОТИПОВ, ВЫБОРКИ,

ЦЕННЫЕ ГЕНЕТИЧЕСКИЕ КОМПЛЕКСЫ.

Цель данного исследования - проведение комплексного исследования стад костромской породы КРС из разных хозяйств Костромской области по группе генов, ответственных за рост (гены гормона роста и пролактина), качество молока (гены каппа-казеина, гормона роста и пролактина) и устойчивость к заболеваниям (ген BoLADRB3).

Исследования проводили на выборках коров костромской породы из ГКПЗ «Лужки», СПК «Гридино» и ОАО «Минское», и быков из ОАО «Костромское» по племенной работе. Тестирование А- и В-аллелей гена CSN3 проводили с помощью ПЦР-ПДРФ и аллель-специфичной ПЦР.

ДНК-полиморфизм генов bPRL, bGH и BoLA-DRB3 исследовали методом ПЦР-ПДРФ.

Определены частоты аллелей и генотипов по исследуемым генам.

Показано высокое содержание ценных аллелей и генотипов исследованных генов в изученных выборках:

- В-аллеля каппа-казеина (до 59,5%, в целом по породе ), определяющего сыродельческие качества молока;

- генотипа L/L по гену гормона роста (до 95%), ассоциированного с высоким содержанием жира и белка в молоке и большим приростом массы тела;

- генотипа АА по гену пролактина (до 73,7%), ассоциированного с высоким содержанием белка в молоке;

- аллелей гена BoLA-DRB3, определяющих устойчивость к лейкозу (до 44,8%, в целом по породе - 36%) и клиническому маститу (до 34,3%, в целом по породе - 24,1%).

Таким образом, в результате проведенных исследований показана уникальность костромской породы, которая заключается в редком сочетании ценных генетических комплексов, одновременно обеспечивающих высокое качество молока, большой прирост массы тела и высокий уровень устойчивости к заболеваниям. Генетический потенциал костромской породы не исчерпан. Она является одной из лучших отечественных пород и может быть с успехом использована в животноводческих хозяйствах как молочного, так и мясного направления.

Раздел 3. Разработка и исследование автоматизированной системы управления технологическим процессом подработки зерновых колосовых культур методом термодинамического воздействия

–  –  –

Цель работы – анализ конструкций, компонентов и режимов существующих систем управления технологическим процессом подработки зерновых культур методом термодинамического воздействия;

отбор наиболее рациональных вариантов, обоснование технических решений.

В отчёте представлены существующие системы автоматического регулирования, управления и защиты технологического процесса сушки, проведен анализ выпускаемых промышленностью датчиков для контроля параметров сушки сушилок термодинамического воздействия. На основании анализа предложена схема технологического контроля процесса сушки в установках термодинамического воздействия.

Разработан экспресс-метод определения структуры зернового слоя, позволяющий контролировать порозность слоя зернового материала в потоке.

Раздел 4. Разработка и изготовление макетного образца усовершенствованного ресурсосберегающего аппарата для отделения семенной части урожая от стеблей при раздельной уборке льна Ключевые слова: ЛЕН, РАСТЕНИЯ, СТЕБЛИ, КОРОБОЧКИ,

ТЕХНОЛОГИЯ, УБОРКА, РАЗДЕЛЬНАЯ УБОРКА, МАШИНА,

АППАРАТ, ПЛЮЩЕНИЕ, ПЛЮЩИЛЬНЫЙ АППАРАТ, ОЧЕС,

ОЧЕСЫВАЮЩИЙ АППАРАТ, КОМБИНИРОВАННЫЙ АППАРАТ,

ПОДБОРЩИК-ОЧЕСЫВАТЕЛЬ.

Цель НИР - разработка и изготовление макетного образца усовершенствованного ресурсосберегающего аппарата для отделения семенной части урожая от стеблей при раздельной уборке льна-долгунца.

В отчете приведены обоснование необходимости выполнения работы и анализ известных аппаратов для отделения семенной части урожая от стеблей льна, разработана технологическая схема усовершенствованного ресурсосберегающего аппарата для отделения семенной части урожая от стеблей при раздельной уборке льна-долгунца, проведено изготовление макетного образца усовершенствованного аппарата.

Раздел 5. Разработка методических рекомендаций по применению научно-обоснованных нормативов потребности в технике, топливе и рабочей силе для растениеводства на основе компьютерного моделирования машиноиспользования Ключевые слова: НОРМАТИВЫ, РАСТЕНИЕВОДСТВО,

МАШИННО-ТРАКТОРНЫЙ ПАРК, ИСПОЛЬЗОВАНИЕ ТЕХНИКИ,

МОДЕЛИРОВАНИЕ, КОМПЬЮТЕРНАЯ ПРОГРАММА,

ОПЕРАТИВНОЕ УПРАВЛЕНИЕ, СТРУКТУРНО-ТЕХНОЛОГИЧЕСКАЯ

СХЕМА.

Объектами исследования являются различные нормативы, связанные с использованием техники и рабочей силы, производственные процессы, методы, модели и компьютерные программы для моделирования машиноиспользования в растениеводстве.

Цель НИР — повышение эффективности управления сельхозпредприятием за счет применения компьютерных технологий.

Рассмотрены вопросы, связанные с моделированием, оптимизацией, структурно-технологическими схемами [5.5], сетевым планированием [5.10] при машиноиспользовании.

Результатом работы является научно обоснованная методика применения нормативов в компьютерной программе «Машиннотракторный парк» версии 2011, предназначенной для компьютерного моделирования машиноиспользования, а также методика ее применения.

Созданная компьютерная программа является современной, обладает низкими системными требованиями, автономностью, может быть применена в любом хозяйстве (занимающемся производством продукции растениеводства), сопровождается подробным описанием.

Может использоваться для планирования, оперативного управления, рационализации машиноиспользования; количественного обоснования разнообразных управленческих решений; для оценки последствий применения той или иной системы нормативов (или отдельных нормативов); уточнения значений нормативов в условиях конкретного хозяйства; разработки новых нормативов, получения справочных сведений о нормативах.

В результате применения программы хозяйства смогут более эффективно использовать имеющиеся ресурсы, сократить расходы, и количественно обосновать наиболее выгодные варианты вложения средств. Помимо сельхозпредприятий, программа может использоваться в научно-исследовательской работе и консультационных службах для разработки рекомендаций по применению техники и рабочей силы.

В 2011 году программа использовалась в ОАО «Племзавод Караваево» Костромского района, а также в учебном процессе Костромской ГСХА.

1 РАЗРАБОТКА ЭКОЛОГИЧЕСКИ БЕЗОПАСНЫХ,

РЕСУРСОСБЕРЕГАЮЩИХ ТЕХНОЛОГИЙ ВОЗДЕЛЫВАНИЯ

ПОЛЕВЫХ КУЛЬТУР НА ОСНОВЕ ИНТРОДУКЦИИ,

МИНИМАЛИЗАЦИИ ОБРАБОТКИ ПОЧВЫ,

СОВЕРШЕНСТВОВАНИЯ СЕВООБОРОТОВ И

ВОСПРОИЗВОДСТВА ПЛОДОРОДИЯ ДЕРНОВО-ПОДЗОЛИСТЫХ

ПОЧВЫ ВЕРХНЕГО ПОВОЛЖЬЯ

–  –  –

В Костромской области ресурсосберегающие технологии и повышение эффективности ведения севооборотов за счет введения в них товарных интродуцируемых культур, рассматриваются как перспективный способ ведения сельскохозяйственного производства.

По России более 560 тыс. гектаров (40 % площадей зерновых культур) засевается по ресурсосберегающей технологии, в том числе нулевой посев (без предварительного рыхления) достигает 210 тыс. гектар.

В ресурсосберегающей технологии центральным объектом является специфика адаптивных реакций биотических компонентов экосистемы, и, в первую очередь, возделываемых культур и сортов. В связи с этим, введение в зональную культуру земледелия интродуцируемых растений является фактором повышения уровня интенсификации отрасли растениеводства.

Для Нечерноземной зоны России соя является малораспространенной. Значимость и востребованность сои в России возросли из-за обострения дефицита белка в связи со снижением производства животноводческой продукции в последние 15 лет.

Соединение научной ценности подбора культур и технологий представлено в отчете в виде двух подразделов: «Роль ресурсосберегающих технологий возделывания полевых культур с использованием минимальных приемов обработки почвы» и «Интродукция сои в условиях Костромской области».

1.2 Современное состояние изучаемого вопроса 1.2.1 Принципы и способы перехода от традиционного земледелия к ресурсосберегающим технологиям Переход на ресурсосберегающие технологии необходимо осуществлять последовательно и планомерно в течение 3-4 лет, создавая поэтапно, постепенно преимущества сберегающего земледелия. В этот период происходят положительные изменения биологических, агрохимических, агрофизических и других свойств почвы, почва становится «живой», начинает повышаться продуктивность культур.

Установлено, что минимальная обработка и прямой посев в сочетании с рациональным применением систем удобрений и пестицидов, использованием правильных севооборотов могут применяться в различных агроклиматических зонах. Практически все виды почв различного гранулометрического состава пригодны для освоения минимальных и нулевых систем обработки. Даже на малогумусных и плохо дренированных глинистых почвах, при внедрении сберегающих технологий в течение 3-4 лет после отказа от плуга, происходит постепенное улучшение физических и биологических свойств почвы.

Во избежание уплотнения почвы, создания и сохранения достаточно большой и стабильной системы пор, за счет соответствующих обработок и севооборотов, все почвы сельскохозяйственного назначения могут с успехом обрабатываться без плуга.

Перед переходом на сберегающие технологии необходимо провести ряд организационных и агротехнических мероприятий. Вначале следует собрать и оценить информацию для создания топографических планов полей, почвенных и агрохимических карт, баз данных о сорняках, заболеваниях растений, вредителях, планов урожайности различных участков полей.

Вторым этапом при переходе на сберегающие технологии является выравнивание поверхности поля, разрушение плужной подошвы глубокорыхлителями, чизельными плугами или с помощью специально подобранного севооборота.

При использовании минимальной и нулевой обработки почвы важно включать в севооборот культуры, повышающие почвенное плодородие. Использование в севообороте бобовых культур позволит сэкономить значительное количество азотных удобрений, а использование культур с глубоко проникающими в землю корнями (рапс, редька) — снять проблему плужной подошвы, доставшейся от традиционной технологии, и улучшить структуру почвы без механических обработок.

Важным этапом при переходе на сберегающие технологии является составление технологических карт возделывания сельскохозяйственных культур, на основе которых определяется необходимая техника и ее количество для проведения полевых работ в оптимальные агротехнические сроки.

Составной частью переходного периода является работа с кадрами. Очень важно привить трудовому коллективу понимание того, что ресурсосберегающие технологии это не упрощение традиционных технологий, они требуют высокой дисциплины и творческого подхода, а пренебрежение одной технологической операцией или некачественное её исполнение может погубить труд всего коллектива.

1.2.2 Современные подходы к ресурсосберегающим технологиям

Построение технологии начинается с выбора сорта, ошибка на этом этапе ведет к высоким энергетическим издержкам пестицидов и недостатка органики, поступающей в почву.

В современных технологиях возделывания зерновых культур, основанных на бесплужных обработках почвы, растительные остатки сохраняются на поверхности. Снижения численности болезней и вредителей зерновых культур можно добиться путем их чередования с многолетними и однолетними бобовыми культурами, рапсом и другими.

Использование растительных остатков. Начинать необходимо с уборки. Солому при этом нужно измельчать на отрезки длиной не более 50-100 мм. Высота стерни не должна превышать ширину междурядий сеялки более чем на 5 см. Продукты распада соломы не являются токсичными для растений, если посев проводить протравленными семенами (Чернов Н.В., 2005).

Измельчённая солома более влагоёмка и гигроскопична, равномернее распределяется в почве и становится доступнее для микрофлоры. Из каждой тонны соломы, внесённой в почву, образуется 1,5-2,0 ц гумуса. Технологию поверхностного компостирования растительных остатков предложили Р.Ф.Еремина, С.С. Мащенко и др., (2005).

Важно включать в севообороты культуры, повышающие плодородие почвы. Бобовые экономят количество вносимых азотных удобрений, а растения с глубоко проникающей в землю корневой системой, помогут бороться с плужной подошвой и улучшать структуру почвы без механических обработок.

Схема чередования культур в севообороте может быть такой:

–  –  –

Большое значение отводится выбору сортов. Они должны быть интенсивного типа, устойчивыми к болезням, адаптированными к местным климатическим условиям.

Обработка почвы. В первые 2-3 года для выравнивания поля и сглаживания свальных и развальных борозд осенью после уборки предшественника проводится обработка культиватором «Смарагд» или «Vogel» на глубину 8-10 см. В дальнейшем её осуществляют на глубину заделки семян (6-8 см).

Удобрения. Использование ресурсосберегающих технологий вызывает замедление минерализации органического вещества и выделения азота. Поэтому первые 2-3 года работы его понадобится на 10-20% больше, чем при традиционных технологиях. На 1 тонну соломы необходимо вносить 10-12 кг азотных удобрений. Наибольший эффект достигается при локальном внесении удобрений при посеве, но с увеличением обеспеченности почвы элементами питания зависимость урожайности от способа внесения нивелируется.

Посев при наступлении физической спелости почвы проводится без боронования и предпосевной культивации специальными сеялками.

Не рекомендуется завышать нормы посева и слишком глубоко заделывать семена. Оптимальная глубина посева – не более 3-4 см.

Защита посевов. Необходим мониторинг состояния земель и хорошее знание гербицидов. Использование препаратов сплошного действия на основе глифосата (Глисол, Ураган, Раундап, Глиалко (36% ВР., 5-6 кг/га)) на паровых полях или за 3-5 дней до посева культуры – важный элемент борьбы с сорняками в сберегающих технологиях, особенно в переходный период при сильной засоренности или наличии залежных земель.

Биологически активные вещества используются одновременно с протравителями, что предусматривает снижение нормы расхода последнего на 50%. Первая обработка проводится в межфазный период кущения-выхода в трубку одновременно с внесением гербицидов, вторую совмещают с опрыскиванием фунгицидами против заболеваний, третья проводится вместе с проведением защитных работ против клопачерепашки. При этом норму расхода всех препаратов снижают на 50% при использовании БАВ. Это гарантирует стабильную урожайность и повышение её ежегодно на 15%. По всходам культуры для борьбы с сорняками используются препараты избирательного действия (Луварам, Чисталан, Гренч, Диален, Секатор, Пума-супер).

Представляя короткий анализ направления ресурсосбережения и экологизации земледелия, мы многократно убеждаемся в необходимости усиления зональных исследований, избирательном применении наукоемких ресурсосберегающих технологий. Сущность методики разработки и применения ресурсосберегающих технологий заключается в их адаптации к агроэкологическим условиям с учетом уровня развития производства и организации хозяйственной деятельности конкретного предприятия.

1.3 Роль ресурсосберегающих технологий возделывания полевых культур с использованием минимальных приемов обработки почвы 1.3.1 Цели и задачи исследований Целью работы является разработка и внедрение ресурсосберегающей технологии возделывания яровых и озимых зерновых культур с применением комплекса машин в производственных условиях ООО «Сущево» Костромского района Костромской области.

Для перехода к ресурсосберегающей технологии в хозяйстве необходимо было провести ряд организационных и агротехнических мероприятий:

1) Собрать и оценить информацию для выявления состояния полей.

2) Провести почвенные и агрохимические обследования.

3) Сформировать базу данных о сорняках, заболеваниях растений.

4) Оценить урожайность за предыдущие годы и задать планируемую на перспективу.

Для достижения поставленных целей необходимо решить следующие задачи:

1. Определить полевую всхожесть зерновых культур (озимой тритикале) по изучаемым вариантам обработки почвы.

2. Определить густоту стояния растений в фазу полных всходов и перед уборкой.

3. Определить плотность почвы по разным слоям пахотного горизонта, приурочивая отборы к фазам: весеннее кущение, цветение, полная спелость.

4. Определить видовой и количественный состав сорной растительности на различных вариантах обработки.

5. Определить микробиологическую активность почвы в динамике и по разным слоям пахотного горизонта.

6. Разработать технологическую карту выращивания озимой тритикале.

7. Разработать план перехода хозяйства к ресурсосберегающим технологиям.

1.3.2 Условия научно-исследовательской работы и методика исследований Объекты исследований и схема опыта. Характеристика почвенного участка для проведения исследований Исследования проводились на поле у д. Невежино, примерно в 1,2 км севернее центральной усадьбы ООО «Сущёво» – села Сущёво на поле № 7, имеющем 2 контура (рис. 1.1).

Рисунок 1.1 - Схема расположения поля и контуров (вспашка — контур 1, слева; min (культивация) — контур 2, справа)

Контур 1, площадь 38,5 га, имеет следующие характеристики:

содержание гумуса– 3,4%, содержание подвижного фосфора– 328 мг/кг почвы, содержание обменного калия– 241 мг/кг почвы, рН– 5,1-5,5.

Контур 2, площадь 48,3 га, имеет следующие характеристики:

содержание гумуса– 3,2%, содержание подвижного фосфора– 390 мг/кг почвы, содержание обменного калия– 171 мг/кг почвы, рН– 5,6-6,0.

Схема исследований

В 2011 году изучали два варианта:

1. Вспашка плугом на полную глубину пахотного горизонта (контур 1);

2. Культивация культиватором Vogel Terramix 600, взамен вспашки (контур 2).

Характеристика посевного материала Культура – Озимая тритикале Сорт – Корнет Репродукция – I Норма посева – 200 кг/га.

Методики проведения исследований

1. Учет густоты стояния растений проводили в период весеннего кущения-выхода в трубку и в фазу полной спелости, перед уборкой, по методике Майсуряна Н.А (1970).

2. Влажность и плотность почвы, пористость, запас воды в почве определяли по методике Доспехова Б.А. и др. (1987).

3. Микробиологическую активность почвы определяли методом льняных полотен (Доспехов Б.А., 1977).

4. Определение токсичности почвы проводили в лабораторных условиях по методу Красильникова Н.А. (Сэги Й., 1979).

5. Учет засоренности проводили одновременно с учетом густоты стояния растений количественным методом. Одновременно определялся видовой состав сорных растений (Степанов Н.С., Костецкий И.И., 1981).

6. Определение биологической урожайности и её структуры проводили методом пробных снопов. Снопы отбирались с учетных площадок 0,25 м2 по диагонали поля.

1.3.4 Результаты исследований роли ресурсосберегающих технологий возделывания полевых культур с использованием минимальных приемов обработки почвы Изучение ресурсосберегающей технологии выращивания зерновых культур в условиях ООО «Сущево» обеспечило получение следующих положительных результатов.

1.3.4.1 Метеорологические условия Метеорологические условия 2011 года характеризовались неравномерным распределением влаги и тепла в течение периода вегетации. Перепады температур имели меньшие колебания от среднемноголетних значений, чем количество осадков.

Следует отметить, что апрель 2011 года оказался значительно теплее, чем обычно, особенно первая и вторая его декада (рис. 1.2).

Средняя температура воздуха в мае находилась на уровне или чуть выше среднемноголетних значений, при этом количество выпавших осадков в первые две декады мая было на 27,9 и 48,4% ниже нормы соответственно.

Температура воздуха в период активного роста и цветения тритикале в июне незначительно отличалась от среднемноголетних значений, с превышением её в первой и третьей декаде и с уменьшением – во второй. При этом количество осадков за этот период имело более высокую градацию, особенно в первую декаду, когда осадков выпало только 20% от нормы. Количество осадков во вторую декаду месяца находилось в пределах нормы, а в третью декаду – превышало норму на 25,8% (рис. 1.3).

В период формирования и налива зерна в июле 2011 года погодные условия отличались достаточно высокой температурой, превышающей норму по декадам месяца на 23,8; 15,7 и 32,0% соответственно. Режим увлажнения, также как и в июне этого года, имел более резкие перепады с более сухими условиями в первой декаде месяца, практически оптимальными условиями увлажнения во второй декаде и с небольшим превышением нормы в третьей декаде июля (125,8% от нормы).

Период налива и созревания зерна озимой тритикале, проходящий в августе 2011 года, был наиболее оптимальным для развития культуры, по погодным условиям. В это время наблюдалась достаточно теплая погода с небольшим количеством осадков (во вторую и третью декаду месяца выпало всего около 28% осадков от нормы), что является наиболее благоприятным фактором для лучшего созревания зерна.

1.3.4.2 Влияние приемов обработки на плотность и пористость почвы

Повышенная плотность неблагоприятно отражается на водном режиме, газообмене и биологической активности почвы. Поэтому, чем суше почва, тем больше угнетаются растения. С увеличением плотности на 0,1 г/см3 содержание недоступной для растений влаги возрастает на 10%.

От излишней плотности снижается полевая всхожесть семян, уменьшается глубина проникновения корней и их объем, нарушается форма корней. Оптимальная плотность почвы для зерновых культур на дерново-подзолистых почвах находится в диапазоне 1,22 – 1,4 г/см3.

Анализ этого показателя в условиях ООО «Сущево» проводился по двум слоям пахотного горизонта: 0-10 и 10-20. Если вспашка проводилась на глубину около 20 см, то поверхностная обработка достигала глубины только 10 см. В результате планировалось выяснить степень влияния глубины обработки на показатель плотности почвы.

В целом плотность почвы в 2011 году значительно отличалась как по вариантам обработки почвы, так и по слоям пахотного горизонта. При этом более высокой плотностью обладал вариант с минимальной обработкой почвы.

1,45

–  –  –

Анализируя плотность более глубокого слоя пахотного горизонта (10-20), отмечаем резкое увеличение этого показателя в варианте с минимальной обработкой по сравнению со вспашкой. Если в варианте со вспашкой плотность в этом слое была на уровне слоя 0-10 см, то на минимальной обработке показатель плотности достиг 1,40 г/см3.

В середине вегетации, в фазу цветения тритикале (рис. 1.6), плотность почвы в варианте со вспашкой по обоим исследуемым слоям пахотного горизонта оказалась несколько ниже, чем в предыдущий период наблюдений и составила 1,23 г/см3 – в слое 0-10, и 1,22 г/см3 – в слое 10-20.

Рисунок 1.6 - Общий вид поля в фазу цветения (контур 1)

В варианте с поверхностной обработкой в слое 0-10 см произошло повышение плотности на 8,6% (до 1,39 г/см3) по сравнению с предыдущим исследованием. Анализируя более глубокий слой пахотного горизонта на варианте с поверхностной обработкой, отмечаем, что по сравнению с предыдущей фазой растений плотность почвы снизилась незначительно на 1,4%, до 1,38 г/см3. При этом плотность почвы в варианте с поверхностной обработкой достоверно была выше варианта со вспашкой.

На момент полной спелости озимой тритикале (рис. 1.7) ситуация не изменилась.

В целом, показатели плотности почвы по вариантам обработки в 2011 году отвечали требованиям озимой тритикале, и внешнего проявления угнетения растений отмечено не было.

Анализируя полученные результаты, отмечаем, что за вегетационный период 2011 года пористость почвы по вариантам опыта варьировала от 45 до 53%.

Рисунок 1.7 - Общий вид поля в фазу начала полной спелости (контур 1) При этом несколько большие значения этого показателя отмечены в слое почвы 10-20 см, по сравнению с верхним десятисантиметровым слоем пахотного горизонта (табл.

1.2).

–  –  –

В течение вегетационного периода, по фазам развития, общая пористость по вариантам опыта изменялась разнонаправленно. Если в варианте с поверхностной обработкой в десятисантиметровом слое почвы пористость, по фазам развития тритикале, несколько снижалась, то в варианте со вспашкой, этот показатель имел некоторое превышение в динамике. Такая же тенденция отмечается при анализе более глубокого слоя пахотного горизонта.

Для того чтобы сделать общий вывод о степени уплотнения почвы по двум сравниваемым вариантам обработки, необходимо воспользоваться данными табл. 1.3.

–  –  –

1.3.4.3 Изменение влажности почвы в зависимости от приемов обработки почвы При разработке и внедрении новых приемов обработки почвы важно знать их влияние на сохранение и накопление запасов продуктивной влаги.

Неравномерное выпадение осадков в 2011 году, приемы обработки почвы и глубина отбора проб оказали влияние на её влажность (рис. 1.8).

Градация колебания влажности по слоям пахотного горизонта в обоих вариантах была сильнее выражена в верхнем слое пахотного горизонта, чем в нижней его части.

Ранее отмечалось, что погодные условия апреля - начала мая были не характерными для нашей зоны.

25,00

–  –  –

Рисунок 1.8 - Влажность почвы по вариантам обработки в 2011 году Все это привело к тому, что растения озимой тритикале раньше перешли к весенней вегетации и уже к середине мая находились в фазе начала выхода в трубку.

Такие погодные условия отразились и на показателе влажности почвы на эту фазу развития культуры (табл. 1.4).

Анализируя влажность почвы на этот период, отмечаем, что в вариантах опыта она колебалась в пределах от 15,38 до 19,41%. При этом вариант с поверхностной обработкой значительно уступал по этому показателю варианту с применением вспашки по обоим анализируемым слоям пахотного слоя.

–  –  –

К моменту начала цветения культуры (третья декада июня) погодные условия также отличались от нормы. Анализируя полученные результаты, отмечаем, что по обоим вариантам опыта влажность верхнего 10-ти см слоя почвы была значительно выше, нижележащего слоя.

Засушливые условия первой декады июня сильнее проявились на влажности нижней части пахотного горизонта. По сравнению с предыдущим исследованием, влажность в этом слое почвы значительнее снизилась в варианте со вспашкой до 10,70% (уменьшение составило 8,71%), в варианте с поверхностной обработкой почвы до 12,96% (уменьшение составило 2,67%).

К концу вегетационного периода, при созревании тритикале, погодные условия были на уровне среднемноголетних значений лишь с небольшим превышением температуры воздуха. В этих условиях, при созревании зерна, корневая система активно поглощала воду из почвы, что привело к тому, что влажность почвы в этот период оказалась наименьшей за все исследуемые периоды. Особенно это проявилось в верхней части пахотного горизонта. В результате влажность почвы, по сравнению с предыдущим обследованием, значительно снизилась в варианте с поверхностной обработкой почвы и достигла 9,31% (снижение достигло 8,49%). В варианте со вспашкой снижение было также значительным по сравнению с предыдущим отбором образцов и достигло 9,42%, при влажности 12,12%.

Как уже отмечалось выше, нижний слой пахотного горизонта отличался меньшими колебаниями влажности почвы. При этом большей влажностью обладал вариант со вспашкой, где влажность достигла 13,74%, по сравнению с поверхностной обработкой, где влажность была на уровне 11,17%.

Для выявления пригодности почвы по влажности к обработке, сравним полученные результаты с оптимальными значениями (табл. 1.5).

–  –  –

В целом, можно отметить, что влажность в вегетационный период 2011 года находилась в пределах агротехнически допустимой для обработки почвы.

1.3.4.4 Видовой состав и численность сорных растений в агроценозе Считается, что применение поверхностной обработки почвы сопровождается увеличением количества наиболее вредоносных многолетних сорных растений. Но применение гербицидов при освоении ресурсосберегающих технологий обеспечивает положительные результаты. Этот факт нашел подтверждение при проведении исследований на базе ООО «Сущево». Обработка посевов зерновых культур гербицидами в вариантах с поверхностной обработкой почвы и вспашкой способствовала подавлению численности многолетних сорных растений в посевах тритикале.

Численность сорных растений в посевах озимой тритикале в 2011 году значительно варьировала как по вариантам обработки, так и по фазам развития культуры (табл. 1.6).

–  –  –

Анализ засоренности проводился в фазы выхода в трубку и цветения.

На момент фазы цветения засоренность посевов озимой тритикале имела аналогичную ситуацию, как и в фазу выхода в трубку. При этом, наибольшая численность сорняков отмечена в варианте со вспашкой, наименьшая – в варианте с поверхностной обработкой (рис. 1.9), в обоих вариантах обработки увеличилась доля многолетних сорняков в посеве.

а б Рисунок 1.9 – Засорённость на вариантах минимальной обработки (а) и вспашки (б) Если на предыдущее обследование на минимальной обработке многолетних сорняков отмечено не было, то к моменту цветения культуры их доля от общей численности достигла 8,89%. Численность многолетних сорняков в варианте со вспашкой была более стабильной: в фазу выхода в трубку доля многолетников составляла 2,38% от общей численности, в фазу цветения – 2,56%.

При анализе засоренности посевов сельскохозяйственных культур пользуются шкалой Мальцева (табл. 1.7).

–  –  –

Сравнивая полученные результаты со шкалой Мальцева, отмечаем, что по общей засоренности посевы в варианте с поверхностной обработкой соответствовали 3 баллам, в варианте со вспашкой – 5 баллов, при достаточно низкой засоренности многолетними видами сорных растений в каждом варианте.

1.3.4.5 Микробиологическая активность почвы Микробиологическую активность почвы определяли в пахотном горизонте с интервалом глубины 5 см.

Полученные данные (рис. 1.10, 1.11) показывают, что микробиологическая активность почвы в варианте, где проводилась поверхностная обработка почвы, находится на высоком уровне в течение всего вегетационного периода озимой тритикале. Об этом говорит тот факт, что разложение льняной ткани, под действием микроорганизмов, происходило более интенсивно и активно по сравнению со вспашкой, как через месяц после закладки образцов, так и через два.

100,00 90,00

–  –  –

Рисунок 1.10 - Микробиологическая активность почвы в зависимости от варианта обработки почвы через месяц после закладки льняной ткани Анализируя действие микроорганизмов через месяц после закладки с глубиной пахотного горизонта, на обоих изучаемых вариантах, отмечаем постепенно снижение её с поверхности до глубины 20 см (см.

рис. 1.10).

Варианты обработки почвы значительно повлияли на деятельность почвенной микрофлоры. Наибольшая активность микрофлоры отмечена в верхнем пятисантиметровом слое почвы, где образец в варианте с поверхностной обработкой почвы разложился более чем на 90 %, что в три раза больше, чем на вспашке.

100,00 90,00

–  –  –

Рисунок 1.11 - Микробиологическая активность почвы в зависимости от варианта обработки почвы через два месяца после закладки льняной ткани Изучая действие микроорганизмов на больших глубинах пахотного горизонта, также отмечаем высокую их активность в варианте с поверхностной обработкой, по сравнению с вспашкой (превышение активности на поверхностной обработке колебалось от 1,84 до 4,97 раз по сравнению со вспашкой).

Экологические условия второй половины вегетационного периода 2011 года были менее благоприятными для микроорганизмов (их геному) к напряженности температуры и значительным перепадам влажности почвы. Но и в этих условиях вариант с поверхностной обработкой почвы значительно превышал вариант со вспашкой (см. рис. 1.10). При этом также наибольшая активность микрофлоры отмечена в слое 0-5 см. Экологические условия второй половины вегетационного периода 2011 года были менее благоприятными для микроорганизмов (их геному) к напряженности температуры и значительным перепадам влажности почвы.

Но и в этих условиях вариант с поверхностной обработкой почвы значительно превышал вариант со вспашкой (см. рис. 1.11). При этом также наибольшая активность микрофлоры отмечена в слое 0-5 см. Активность микрофлоры также зависела от влажности почвы по профилю пахотного горизонта. На момент второго отбора образцов влажность нижней части пахотного горизонта была больше, чем средней, что привело к увеличению активности микрофлоры в этих слоях.

В целом через два месяца после закладки полотен действие микрофлоры в варианте с поверхностной обработкой обеспечило разложение в среднем более чем 74% образца, в то время как в варианте с вспашкой – только около 50% (рис. 1.12).

Рисунок 1.12 - Разложение льняной ткани в варианте вспашки Отбор образцов в конце вегетации культуры, через три месяца после закладки, провести не удалось из-за полного разложения льняных полотен по обоим вариантам обработки.

Кроме анализа активности микрофлоры в почве в течение вегетации культуры, был заложен опыт в лабораторных условиях, целью которого являлось определение наличия в почве токсичных соединений, способных влиять на прорастание семян (табл. 1.8). Анализируя данные этой таблицы, отмечаем, что оба изучаемых варианта повлияли на прорастание семян пшеницы, по сравнению с контролем. Особенно это проявилось на количестве проростков. Варианты с разной обработкой значительно отличались от контроля по обеим изучаемым глубинам.

Анализируя влияние обработки на этот показатель, отмечаем лучшее прорастание семян в верхней части пахотного горизонта на поверхностной обработке (71,1%) по сравнению с вспашкой (54,3%).

–  –  –

1.3.4.6 Биологическая урожайность и элементы её структуры Конечным итогом любой технологии выращивания полевых культур является определение величины урожая.

В 2011 году в зависимости от варианта обработки почвы получена различная биологическая урожайность зерна, которая колебалась от 5,10 до 5,76 т/га (табл. 1.9).

–  –  –

При определении биологического урожая представляют интерес и элементы, в результате которых он сложился (табл. 1.10).

Анализируя полученные результаты можно отметить, что к моменту уборки культуры густота стояния растений незначительно отличалась по вариантам опыта (рис. 1.14).

–  –  –

Большей величиной этот показатель отмечен в варианте с использованием минимальной обработки и меньшей – в варианте со вспашкой. Однако показатель количества растений не дает полных объективных сведений об урожайности. Это возможно установить по другому элементу урожайности – количеству стеблей и стеблей с колосом, которые, в свою очередь, определяют величину общей и продуктивной кустистости. Наибольшие значения этих показателей отмечены в варианте со вспашкой, хотя отметим также незначительное превышение по сравнению с минимальной обработкой.

а б Рисунок 1.14 - Общий вид поля перед уборкой в вариантах вспашки (а) и минимальной обработки (б) Сравнение элементов структуры урожайности озимой тритикале показало, что в варианте с поверхностной обработкой почвы получен более продуктивный посев. Общая кустистость растений увеличилась на 33,1%, продуктивная кустистость на 9%, высота растений на 2,5%.

Однако, более высокая продуктивная кустистость растений в варианте со вспашкой, не позволила сформировать больший уровень урожайности по сравнению с применением минимальной обработки. Это связано с лучшими показателями развития продуктивного соцветия, в котором выделяли длину колоса, количество колосков в колосе, количество зерен в колосе и массу зерна в колосе. По всем этим показателям вариант с применением поверхностной обработки несколько превышал вариант со вспашкой: длина колоса увеличилась на 5,1%, количество колосков в колосе – на 4,8%, количество зерен в колосе – на 19,8%, масса зерна с колоса – на 14,4%.

Кроме того, вариант с применением поверхностной обработки обеспечил получение более крупного зерна, что характеризуется массой 1000 зерен. В варианте с поверхностной обработкой этот показатель оказался на 5,2% больше, чем на вспашке.

В результате, доля зерна в общей продукции по обоим изучаемым вариантам колебалась в пределах от 48,6% (вспашка) до 51,1% (минимальная обработка). Также следует отметить, что озимая тритикале имеет более узкое соотношение основной и побочной продукции в общем урожае по сравнению с озимой рожью. Если у ржи это соотношение, в среднем, достигает 1:2, то у озимой тритикале оно достигло 1: 0,96-1,01, что связано с небольшой высотой растений (около 82-88 см) и формированием более мощного колоса.

1.3.4.7 Экономическая оценка результата применения элементов ресурсосберегающей технологии Для оценки экономической эффективности применения элементов ресурсосберегающей технологии в условиях ООО «Сущево»

были рассчитаны технологические карты возделывания культуры по вариантам обработки, которые указаны в приложении 1.1. Расчет технологических карт был произведён на фактически полученный уровень урожайности с учетом реально проведенных технологических операций.

В целом можно отметить, что, так как озимая тритикале по обоим вариантам обработки размещалась после картофеля, то вспашка под озимую культуру осенью не проводилась. Поэтому разница в вариантах обработки с точки зрения технологической карты определялась только формированием различного уровня урожайности культуры.

В результате формирования большей урожайности в варианте с поверхностной обработкой, затраты труда на 1 га соответственно оказались выше, чем в варианте со вспашкой (5809,1 руб. на минимальной обработке по сравнению с 5529,9 руб. на вспашке) (табл. 1.11). Однако затраты труда на 1 ц на варианте с поверхностной обработкой оказались на 6,99% ниже, чем на вспашке, что также обусловлено более высоким уровнем урожайности.

Конечным результатом экономической оценки является выявление себестоимости продукции. В итоге, анализируя этот показатель, получили следующие результаты: себестоимость 1 ц при использовании культивации составила 127,67 руб, при вспашке – 137,08 руб.

–  –  –

Анализируя распределение затрат на выращивание озимой тритикале (табл. 12) можно отметить, что большая часть прямых затрат (около 37-39% по обоим вариантам) относится на горючее и автотранспорт. Меньшими затратами выделяются затраты на семена и текущий ремонт – в среднем около 14%.

1.4 Интродукция сои как фактор повышения уровня интенсификации отрасли растениеводства (на примере условий Костромской области) Целью работы по интродукции сои является научно обоснованная разработка и внедрение в производственные условия ресурсосберегающей технологии возделывания сортов сои северного экотипа (на примере условий Костромской области).

Отсутствие конкретных рекомендаций по технологии выращивания сои в условиях Костромской области предполагает дальнейшее изучение этой культуры в полевых опытах для разработки технологии её возделывания и уточнения способов и сроков уборки, послеуборочной обработки зерна, особенностей её выращивания на продовольственные и семенные цели.

Задача исследований: подбор сортов, адаптивный потенциал которых соответствует региональным почвенно-климатическим условиям.

1.4.1 Характеристика почвенного участка для проведения исследований, объекты и схема исследования Опыты с соей были заложены на типичных дерново-подзолистых легкосуглинистых почвах опытного поля ФГБОУ ВПО Костромская ГСХА.

а б Рисунок 1.15 - а – посев сои сеялкой точного высева; б – прикатывание посевов Перед закладкой опыта проводили агрохимический анализ почв участка, где содержание гумуса 1,94%, аммиачного азота 13,08 мг/кг, нитратного азота 2,82 мг/кг, Р2О5 218,9 мг/кг, К2О 128,0 мг/кг, Мо 0,12 мг/кг, В 0,33 мг/кг, Со 0,70 мг/кг, Sе 0,79 мг/кг, рН 5,6, гидролитическая кислотность 1,54 мг-экв/100 г. Параметры почвенных показателей соответствуют требованиям культуры к составу, свойствам и режиму почвы.

Характеристика посевного материала Объектами исследований являлись следующие сорта сои.

Магева. Оригинальные семена, питомник размножения II года, имели следующие характеристики: чистота — 100%, семена основной культуры– 100%, отход – нет, влажность– 13%, всхожесть– 86%, масса 1000 семян– 157,3 г.

Светлая. Оригинальные семена, питомник размножения II года, имели следующие характеристики: чистота– 100%, семена основной культуры– 100%, отход– нет, влажность– 13%, всхожесть– 91%, масса 1000 семян – 153,7 г.

Касатка. Оригинальные семена, питомник размножения I года, имели следующие характеристики: чистота– 100%, семена основной культуры– 100%, отход– нет, влажность– 13%, всхожесть– 90%, масса 1000 семян– 147,3 г.

Гармония. Характеристики семян: чистота– 100%, семена основной культуры– 100%, отход– нет, влажность– 13%, всхожесть– 96%, масса 1000 семян– 130,5 г.

Лидия. Характеристики семян: чистота– 100%, семена основной культуры– 100%, отход– нет, влажность– 13%, всхожесть– 94%, масса 1000 семян– 121,8 г.

Соната. Характеристики семян: чистота– 100%, семена основной культуры– 100%, отход– нет, влажность– 13 %, всхожесть– 96%, масса 1000 семян– 154,6 г.

Соер 4. Характеристики семян: чистота– 100%, семена основной культуры– 100%, отход– нет, влажность– 13 %, всхожесть– 94 %, масса 1000 семян– 159,2 г.

Брянская 11. Оригинальные семена имели следующие характеристики: чистота– 100%, семена основной культуры– 100%, отход– нет, влажность– 11,8%, всхожесть– 88 %, масса 1000 семян– 156,3 г.

Брянская МИЯ. Оригинальные семена имели следующие характеристики: чистота– 100%, семена основной культуры– 100%, отход– нет, влажность– 11,6%, всхожесть– 89%, масса 1000 семян– 146,5 г.

Характеристика химического состава семян приведена в табл. 1.12.

Семена сои указанных сортов получены из ГНУ «Рязанский НИИСХ» РФ, из ФГОУ ВПО «Брянская ГСХА» и ФГОУ ВПО «ДальГАУ» г. Благовещенска.

–  –  –

Схема исследований

Для определения адаптивного потенциала растений сои изучали:

1. три срока посева с интервалом в 5 дней (15, 20 и 25 мая);

2. две нормы посева: 0,8 млн. шт. семян/га и 0,6 млн. шт. семян/га;

3. обработки растений регуляторами роста и микроэлементами: эпин, циркон, селенат натрия, аквамикс-Т, аквамикс;

4. широкорядный (45 см) и рядовой (15 см) способы посева сои с нормами высева:

0,6 млн. всхожих семян на гектар;

0,7 млн. всхожих семян на гектар;

0,8 млн. всхожих семян на гектар.

Для получения объективной информации вели наблюдения за почвой, ростом и развитием сортов сои.

Методика исследований заключалась в следующем.

1. Учет густоты стояния растений и динамики роста растений проводили по методике (ГСИ, 1961).

2. Определение площади листьев проводили весовым методом (Третьяков Н.Н., 1982); фотосинтетический потенциал определяли по методике Ничипоровича А.А. (1963); чистую продуктивность фотосинтеза — по методике Ничипоровича А.А., (1972).

3. Учет урожайности и её структуры проводили по Янову В.И.

(2007).

7. Посевные качества семян определяли по ГОСТ 12038 – 84

8. Математическую обработку данных проводили методом дисперсионного анализа по Доспехову Б.А. (1985).

1.4.2 Результаты исследований интродукции сои в условияхКостромской области

1.4.2.1 Продолжительность вегетационного периода и фаз роста и развития сои Климат Костромской области отличается умеренно теплым летом и продолжительной, холодной и многоснежной зимой. Среднегодовая температура по данным агрометеорологической станции - 3,20С. Сумма активных температур в период вегетации растений находится в пределах 1600– 21300С. Годовая сумма осадков составляет 560-700мм. Регион относится к зоне достаточного увлажнения. Среднемноголетнее значение гидротермического коэффициента колеблется от 1,4 до 1,7. За вегетационный период в годы наших наблюдений этот показатель изменялся от 0,8 до 2,1, а сумма активных температур варьировала от 1573 до 2080°С (табл. 1.13).

–  –  –

Соответствующий агроклиматический потенциал позволяет сортам северного экотипа формировать достаточно высокие уровни урожайности по годам от 1,1–2,5 т/га. Продолжительность вегетационного периода этих сортов (94-135) дней отражает реакцию генотипа на требования к уровню накопления суммы активных температур, как по фазам роста, так и за весь период вегетации.

Из сортов сои Дальневосточной селекции, по результатам вегетационного периода самыми скороспелыми являются Соер-4 и Лидия с продолжительностью вегетационного периода 119-122 дня, соответственно, и с суммарной температурой – 2299,1оС и 2315,4оС.

Период созревания семян сортов сои Гармония и Соната составил 124-127 дней, при сумме эффективных температур 2279.1 -2299,1оС (табл. 1.14).

В сравнении со среднемноголетними значениями, сумма эффективных температур увеличилась в 1,5 раза, а продолжительность вегетационного периода - на 8 дней. Таким образом, мы определили, что в условиях Костромской области сорта северного экотипа созревают раньше, чем сорта Дальневосточной селекции, на 5 -12 дней.

–  –  –

*эф.t, оС – сумма эффективных температур 1.4.2.2 Формирование габитуса растений сои Применение микроэлементов в этих условиях положительно сказывается на росте и развитии растений. Сорта в силу своей реакции поразному реагируют на тот или иной элемент в разные периоды жизни растения. При предпосевной обработке семян сорта Магева выше показатели были на контроле, а в случае с сортами Касатка и Светлая лучше оказались варианты с применением селената натрия в фазах ветвления и бутонизации. В фазе всходов на сорте Касатка выше по высоте были растения с применением нитроаммофоски с кобальтом, но так как превышение над вариантом с селенатом несущественно, то это находится в пределах ошибки опыта. Такая же ситуация у сорта Светлая, но в фазу всходов по высоте лучшим оказался вариант с применением «Аквамикса».

После проведения опрыскивания на всех трех сортах лучшее действие оказал препарат «Аквамикс» (табл. 1.15).

Превышение над контролем у сорта Магева составило 2,4% по высоте растений сои, 2,9% - по количеству листьев на растении, 5,3% - по количеству боковых побегов на растении. У сорта Касатка превышение над вариантом с селенатом натрия по высоте растения на 4,7%, по количеству листьев на растении на 4,2% и по количеству боковых побегов на 5,9%, а у сорта Светлая на 3,8%,7,7% и 3,0% соответственно.

–  –  –

Одним из основных условий успешного функционирования посевов сои является оптимизация питания растений в критические фазы развития путем применения микроэлементов.

Как известно, соя — влаголюбивая культура, наибольшую потребность во влаге растения испытывают в период цветения - налива семян. Резко выраженные засушливые условия сложились в июле августе 2010 года. Именно в этот период наблюдался устойчивый дефицит влаги, ГТК=0-0,12, ППВ=10 %. Крайне неблагоприятные условия напрямую повлияли на формирование урожайности зерна растениями сои, и она сократилась в 1,5-2 раза, по сравнению с предыдущими годами (рис. 1.17)

–  –  –

Рис. 1.17 – Сравнительная урожайность сортов сои Наиболее высокая урожайность - 2,5 т/га была сформирована сортом Магева в 2007 году при достижении суммы активных температур за период вегетации 1780°С и ГТК=1,6 (небольшой избыток влаги).

1.4.2.3 Показатели фотосинтетической деятельности растений Изучение процессов формирования урожайности культурой и показателей фотосинтетической деятельности сортов сои при использовании регуляторов роста показало, что наибольшую площадь ассимиляционной поверхности сформировали растения сои сортов северного экотипа – Светлая и Ланцетная, это отражает высокие адаптивные свойства к условиям избыточного увлажнения (табл. 1.16).

Выраженное положительное влияние на формирование максимальных показателей чистой продуктивности фотосинтеза и урожайности исследуемых сортов оказало применение эпина. Повышение продуктивности сортов в результате применения регуляторов роста отмечено по сорту Светлая на 38 % - эпин и на 15 % - аквамикс-Т;

Ланцетная на 23% - эпин и 6% - аквамикс-Т ; Свапа 13 % - эпин и 12 аквамикс-Т.

Статистическая обработка экспериментальных данных, проведенных методом дисперсионного анализа по Б.А. Доспехову (1989), показала существенное влияние применяемых регуляторов на продуктивность культуры сои.

–  –  –

1.4.2.4 Биологическая урожайность и элементы её структуры В опыте, заложенном на опытном поле ФГБОУ ВПО Костромская ГСХА изучали также три срока посева с интервалом в 5 дней (15, 20 и 25 мая), две нормы высева: 0,8 млн. шт. семян/га, и 0,6 млн. шт.

семян/га и три сорта сои северного экотипа.

Анализ структуры урожая сои на примере сорта Магева, сформированного в этих условиях, показал, что наиболее оптимальные условия для слагаемых формирования урожая складывались при втором сроке посева (табл. 1.17).

Так, число бобов у растений сои с м2 превысили эти показатели на 20 и 16 %. в сравнении с контролем по обеим нормам высева, при одинаковом количестве числа зерен в бобе. Данные таблицы свидетельствует о том, что урожайность сои сорта Магева выше по второму сроку посева, с изучаемыми нормами высева на 0,41 т/га. в сравнении с контролем.

–  –  –

1.4.2.5 Экономическая оценка результата Для оценки экономической эффективности возделывания сои в условиях опытного поля «Костромской» ГСХА были рассчитаны технологические карты на запланированный уровень урожайности культуры 10 и 25 ц/га.

Оценка экономической эффективности возделывания сои на урожайность 10 ц/га и 25 ц/га показала получение рентабельности от 3 до 130% (табл. 1.18).

В структуре прямых и производственных затрат (табл. 1.18) высокий удельный вес (20…22%) занимают семена. Учитывая высокую потребность в семенном материале сои рационально вести семеноводство сортов сои северного экотипа даже в условиях Костромской области.

В приложении 1.2 представлена технологическая карта выращивания сои, где отражен весь комплекс технологических работ, связанных с производством сои, потребностью в производственных ресурсах и их использовании.

–  –  –

1.5 Рекомендации производству Совершенствование технологии возделывания сельскохозяйственных культур и повышение рентабельности производства возможно на основе конкретного практического знания особенностей почвы, климата, сельскохозяйственных культур, с.-х.

техники, а также учета социального фактора и многого другого.

На сегодняшний день хозяйству следует соблюдать определенные принципы сберегающего земледелия:

1. оставлять растительные остатки на поверхности почвы в измельченном виде;

2. применять гербициды системного действия на основе глифосатов;

3. против корневых гнилей, снежной плесени, мучнистой росы, пятнистостей вести опрыскивать посевы в фазу кущения фундазолом, беназолом, беномилом (0,3-0,6 л/га) дополнительно к протравливанию семенного материала;

4. вести минимальную механическую обработку почвы, постепенно уменьшая её глубину от 16 до 8 см;

5. использовать севообороты, включающие рентабельные культуры и культуры, улучшающие плодородие почвы (клевер красный, люпин узколистный, лядвенец рогатый). Для зоны нормального увлажнения рекомендуются зернопропашные, зернотравяные или зерно-травянопропашные виды севооборотов. Первые включают в себя 60-80% зерновых и 20-40% пропашных и однолетних кормовых культур; вторые – 50-80% зерновых, 10-20% пропашных и 10-20% многолетних трав.

Учитывая это, в условиях ООО «Сущево», для выбранных участков, на которых планируется внедрение ресурсосберегающей технологии, рекомендуются следующие схемы севооборотов:

1. Яровые зерновые (например, яровой ячмень с измельчением соломы),

2. Яровые зерновые с подсевом многолетних трав (например, в качестве покровной культуры яровая пшеница),

3. Многолетние травы 1-го года пользования,

4. Многолетние травы 2-го года пользования,

5. Озимые зерновые (например, озимая пшеница с измельчением соломы) или

1. Занятый пар + мн. травы;

2. Мн. травы I года пользования;

3. Мн. травы II года пользования;

4. Яровые зерновые на корм;

5. Соя (сорта северного типа).

Поскольку почвы в хозяйстве легкие, рекомендуем включить в севооборот узколистный люпин шестым полем севооборота или вместо одного из полей с яровыми зерновыми культурами, что обеспечит более интенсивное разрушение плужной подошвы, положительный баланс органического вещества и улучшит фитосанитарное состояние почвы.

На специфических почвах хозяйства можно использовать зерновой севооборот с короткой ротацией культур:

1. Занятый пар;

2. Озимые зерновые с оставлением соломы на поле;

3. Яровые зерновые с оставлением соломы на поле.

Или кормовой севооборот:

1. Однолетние травы + многолетние травы;

2. Многолетние травы 1 года пользования;

3. Многолетние травы 2 года пользования (поверхностная заделка отавы);

4. Яровые зерновые на корм;

5. Пропашные.

За период наблюдений и исследований в ООО «Сущево» сложилось определенное видение проблем и перспектив внедрения ресурсосберегающих технологий.

Для этого необходимо дальнейшее техническое переоснащение машинно-тракторного парка:

почвообрабатывающие орудия с шириной захвата в пределах 6-8 м – Horsch Optipack 8DD, Smaragd;

измельчитель соломы Master Cut TSL 230 (1 шт.) сеялка дисковая (1-2 шт.) мелкодисперсный опрыскиватель (1 шт.) зерновые комбайны Акрос (2 шт.) силосоуборочный комбайн (1 шт.)

2 АНАЛИЗ ГЕНОФОНДА КОСТРОМСКОЙ ПОРОДЫ

КРУПНОГО РОГАТОГО СКОТА С ИСПОЛЬЗОВАНИЕМ

ДНК-МАРКЕРОВ ПО ГЕНАМ, ОТВЕТСТВЕННЫМ ЗА

РОСТ, КАЧЕСТВО МОЛОКА И УСТОЙЧИВОСТЬ К

ЗАБОЛЕВАНИЯМ

2.1 Введение Костромская порода крупного рогатого скота (КРС), относится к одной из трех пород бурого скота, разводимых в России. Она отличается хорошей энергией роста, крепостью конституции, стойкой передачей признаков потомству, хорошим качеством молока. Порода считается одной из наиболее продуктивных пород комбинированного направления селекции. Животные костромской породы молочно-мясного направления уникальными биологическими продуктивности характеризуются качествами. Они хорошо приспособлены к местным условиям кормления и содержания, обладают крепкой конституцией, хорошим здоровьем, высокой устойчивостью к заболеванию лейкозом, высокими удоями в течение длительного срока хозяйственного использования (Сидоренко, 2004). Генетический потенциал молочной продуктивности коров данной породы позволяет получать свыше 6000 кг в год, а от рекордисток получают 10-16 тыс. кг с высоким (3,9 – 4,0 %) содержанием жира и белка (3,49 – 3,64 %) в молоке (Лягин, Бадин, 2004). Уникальной особенностью костромской породы является повышенное содержание белка в молоке и высокий качественный состав белковых фракций.

Костромская порода исследовалась многими авторами с использованием различных типов маркеров, среди которых маркеры белков крови, маркеры генов белков молока – лактальбумина и казеинов и т д. (Баранов, 1997; Богданова и др., 2003; Лазебная и др., 2010). Однако всесторонние исследования генофонда костромской породы на молекулярно-генетическом уровне с использованием ДНК-маркеров по генам, ответственным за рост, качество молока и устойчивость к заболеваниям, не проводились.

Целью данной работы было проведение комплексного исследования стад костромской породы КРС из разных хозяйств Костромской области по группе генов, ответственных за рост (гены гормона роста и пролактина), качество молока (гены каппа-казеина, гормона роста и пролактина) и устойчивость к заболеваниям (ген BoLADRB3).

<

2.2 Обзор литературы

К генам, ответственным за рост и качество молока, относятся гены, кодирующие белковые гормоны пролактин (PRL, лактогеный гормон, маммотропин, лютеотропный гормон), гормон роста (GH), и хорионический соматомаммотропин (соматотропин, плацентарный лактоген, PL). Все они представляют собой семейство белковых гормонов, обладающих значительной гомологией последовательностей.

Все три гормона имеют общие антигенные детерминанты и оказывают сходное действие: обладают рост-стимулирующей и лактогенной активностью.

Хотя PRL первоначально был идентифицирован как лактотропный гормон, секретируемый гипофизом, к настоящему времени накоплено много данных о разнообразии физиологических функций PRL, включая осморегуляцию, репродукцию, поведенческие реакции (Ben-Jonathan et al.,1996, Bole-Feysot et al.,1998). Было показано также, что PRL синтезируется в различных тканях, включая эндотелиальные и иммунные клетки, нейроны и др. (Clapp et al.,1998, Ben-Jonathan et al.,1996). Более того, участие PRL в регуляции иммунного ответа привела к созданию концепции о двойной функциональной роли PRL – как гормона и как цитокина (Ben-Jonathan et al.,1996). Роль PRL как цитокина подтверждается сходством структуры PRL с белками семейства цитокина/гематопоэтина (Bazan, 1989), а рецептора PRL с рецепторами цитокина и гематопоэтина (Corbacho et al.,2000 ). PRL участвует в инициации и поддержании лактации у млекопитающих (Akers et al., 1981).

Многие биологические функции, такие, например, как экспрессия генов казеинов, осуществляется через рецепторы PRL (Hennighausen et al., 1997).

B настоящее время во многих странах гормон роста (GH) человека и животных получают на основе методов генетической инженерии и применяют, в частности, в медицине для лечения карликовости, заживления ран и переломов костей, а в сельском хозяйстве - для увеличения продуктивности скота. Применение гормона ведёт к увеличению мышечной и снижению жировой массы тела. Ещё не всё известно о механизмах действия гормона, но ясна его ключевая роль в организме. Основной и самый важный эффект гормона роста - это влияние на белковый обмен. GH стимулирует поступление аминокислот в клетку, а также существенно повышает скорость синтеза белка в независимости от транспорта аминокислот. Эти изменения происходят вследствие ускоренного синтеза PHK на рибосомах. GH оказывает сильное влияние на обмен углеводов и жиров и обладает своего рода антиинсулиновым действием. Он вызывает повышение уровня глюкозы в крови за счет торможения ее поступления в клетку, а также за счет образования глюкозы в печени. Существенно ускоряется липолиз - то есть распад жировой ткани, причем продуктами этого процесса являются так называемые свободные жирные кислоты, которые препятствуют действию свободных радикалов.

У КРС ген PRL локализован в области q21 хромосомы 23 и тесно сцеплен с генами класса I и класса II главного комплекса гистосовместимости (Dietz et al., 1992). Наиболее тесное сцепление отмечено между генами PRL и BoLA-DRB3 (Dietz et al., 1992, Lewin et al., 1992). Ген bGH локализован в области хромосомы 19q26 (Hediger et al., 1990). B тканях КРС на гаплоидный геном приходится по одной копии генов GH и PRL (Camper et al., 1984). Обнаружена заметная эволюционная дивергенция этих генов.

Методом полимеразной цепной реакции с последующей рестрикцией амплифицированного продукта (ПЦР-ПДРФ) было изучено несколько полиморфных областей в гене bPRL (Mitra et al., 1995; Chrenek et al., 1998; Unanian et al.,1994/ Так в работе Chrenek et al. (1998) исследован полиморфизм гена PRL с использованием эндонуклеазы Rsal, который, как было показано ранее (Lewin et al.,1992), обусловлен транзицией A - G в кодоне для 103 аминокислоты в экзоне III гена bPRL.

Были выявлены два аллеля (A и B) у трех пород КРС (словацкая пестрая, словацкий пинцгау и герефордская), частота аллеля A составляла у них соответственно — 0,87, 0,68 и 0,95 (Chrenek et al., 1998). При этом генотип BB по гену PRL в данном исследовании у изучаемых пород не был найден (Chrenek et al., 1998).

Тем же методом определен полиморфизм гена PRL у различных видов семейства Bovidae:

сахивальского зебу (Bos indrcus: Sahiwal zebu), буйвола (Bubalus bubalis:

Муррей (Murrah) и Нили/Рави Nili/Ravi), немецкой черно-пестрой и Брауншвейгской пород КРС. Частоты аллеля A гена PRL у сахивальских зебу, буйволов Муррей и Нили/Pави составили 0.51, 0,93 и 0,84 соответственно. У немецкой черно-пестрой и брауншвейгской пород частоты аллеля составили 0,80 и 0,61 соответственно (Mitra et al., 1995). У сахивальских зебу найдены все три генотипа по гену PRL: AA, AB и BB с частотами 0,19, 0,60 и 0,21 соответственно. У буйволов животные с генотипом BB не были выявлены (Mitra et al., 1995). Среди отечественных пород КРС нами была исследована ярославская порода (Хатами и др., 2005). В результате этих исследований впервые у европейских пород Bos taurus (немецкой черно-пестрой и ярославской пород) были обнаружены животные гомозиготные по В-аллелю гена bPRL, ранее описанные только у зебувидного и монгольского скота.

B целом, следует отметить, что сведения о рестрикционном полиморфизме гена PRL крайне ограничены и представлены единичными работами, хотя ген PRL играет важную роль в регуляции лактации.

Функции гена определяют его важную роль в формировании молочной продуктивности КРС. B литературе есть указания на связь одного из вариантов полиморфизма гена PRL, обусловленного наличием делеции/инсерции в гене, с молочной продуктивностью голштинского скота (Cowan et al., 1989). K сожалению, ничего не известно о связи с хозяйственно-полезными признаками других вариантов полиморфизма гена PRL. Возможно, это объясняется низким уровнем информативности выявленных полиморфных вариантов гена, что приводит к необходимости поиска новых подходов анализа полиморфизма ДНК, а также тем, что кодирующие последовательности в гене PRL отличаются высокой консервативностью в сравнении с интронными последовательностями и фланкирующими областями гена (Camper et al., 1984).

Исследование полиморфизма гена bGH имеет практическое значение. Существует ряд независимых исследований ассоциаций этого полиморфизма с молочной продуктивностью, жирностью и содержанием (%) белка у различных пород КРС. Методом ПЦР-ПДРФ было изучено три полиморфных области в гене bGH (Mitra et al., 1995).

Один из изученных маркеров этих областей - сайт узнавания рестрицирующей эндонуклеазы MspI в интроне III гена bGH - оказался информативным для изучения связей с признаками молочной продуктивности. В ряде работ была показана ассоциация MspI(-)-аллеля с высоким уровнем жирности молока, а также с повышением процента белка в молоке (Hoj et al., 1993; Lagziel et al., 1999 a, b). Однако в других работах эта ассоциация не подтвердилась (Yao et al., 1996).

Методом ПЦР-ПДРФ с использованием эндонуклеазы AluI в голштинской, джерсейской и айрширской изучен полиморфизм в гене bGH.

Обнаруженная замена в сайте рестрикции AluI приводила к замене в белковом продукте аминокислоты валин на лейцин в позиции 127:

аминокислота лейцин соответствовала AluI (+), а валин - AluI (-). Для AluI-полиморфизма гена bGH у голштинского канадского скота была описана ассоциация с молочной продуктивностью (Sabour et al., 1996).

Обнаружена корреляция генотипа валин/валин с большим выходом гормона роста в кровь (Lucy et al., 1993; Lee et al., 1993,1996; Grochowska et al., 1999). Нами были изучены связи аллелей гена bGH с показателями молочной продуктивности и впервые были выявлены значимые ассоциации AluI-маркера гена bGH с жирностью молока у ярославского (F=4,50 р= 0,014) и немецкого черно-пестрого скота (F=4,1 p=0,041) (Хатами и др., 2005). В дальнейшем мы исследовали влияние сопряженных генотипов по генам bGH и bPRL на параметры молочной продуктивности. Впервые была показана связь определенных сопряженных генотипов этих генов на качество молока, а именно содержание белка и жира в молоке. Выявлены сопряженные генотипы, определяющие различные сочетания этих параметров молочной продуктивности: высокое содержание и белка и жира в молоке, высокое содержание белка и низкое содержание жира или низкое содержание белка и высокое – жира. Тестирование комплексных генотипов по генам bGH и bPRL позволяет определять генетический потенциал КРС по качеству молока. Способ определения генетического потенциала КРС по качеству молока нами запатентован (Сулимова и др., 2008.

Патент РФ №2317704). Суть метода заключается в определении перспективных комплексных генотипов по AluI-маркеру интрона 5 гена bGH роста и RsaI- маркеру экзона 3 гена bPRL в отношении содержания жира и белка в молоке. Данный способ является современным высокотехнологичным ДНК-диагностическим методом. Его преимущество перед другими заключается в возможности использования разнообразного биологического материала и его результаты не зависят от пола и возраста животного. Он позволяет на ранних этапах проводить отбор телок для молочного животноводства и принимать решение о целесообразности использования быковпроизводителей до появления у них лактирующего потомства, а также осуществлять подбор пар в селекционной работе по улучшению молочных признаков у ярославского КРС. Изобретение может использоваться для получения более точных характеристик потенциала молочной продуктивности животных в товарных и экспериментальных хозяйствах и способствовать сокращению темпов селекции. Кроме того возможно его использование при проведении тестировании животных, закупаемых за рубежом.

Активное участие продуктов генов bGH и bPRL в формировании таких значимых физиологических процессов как рост и лактация служит основанием для продолжения поиска новых значимых ассоциаций полиморфных вариантов указанных генов с конкретными параметрами хозяйственно значимых признаков.

К генам, играющим одну из ключевых ролей в формировании признака молочной продуктивности, относятся гены казеинов. Казеины белки молока, секретируемые клетками молочной железы. В период лактации на их долю приходится до 80% от всех белков, синтезируемых этими клетками. Казеины КРС представлены четырьмя основными группами: альфаS1-, альфаS2-, бета- и каппа-казеинами, составляющими 38%, 10%, 36% и 13% общего белка молока. Гены казеинов у КРС локализованы в районе q31-33 хромосомы 6 и представляют собой кластер из четырех тесно-сцепленных генов, расположенных в следующем порядке: S1,, S2 и. Протяженность кластера составляет около 200 т.п.н. (Threadgill et al., 1990; Feretti et al., 1990; Rijnkels et al., 1997). Группа генов S1-, - и S2-казеинов наиболее тесно сцеплена и формирует эволюционно-родственную семью, тогда как ген каппаказеина (CSN3) отделен от остальных по крайней мере на 70 т.п.н.(Feretti et al., 1990). Синтез казеинов осуществляется на определенной стадии развития, тканеспецифичен и находится под сложным мультигенным контролем. Наименее полиморфны гены казеинов S1 и S2.

Исследования полиморфизма -казеина на белковом уровне показали наличие у КРС одиннадцати аллельных вариантов, из которых наиболее широко распространены - аллели A1, A2 и B. Распространение разных вариантов и их связи с определенными хозяйственно-ценными признаками были предметом множества исследований (Grosclaude et al.,1972; Lien, Rogne, 1984; Fiat, Jolles, 1989; Гладырь и др., 2000;

Калашникова и др., 2002). Каппа-казеины по своей структуре и свойствам значительно отличаются от остальных казеинов, имеют высокий уровень гомологии с гамма-цепью фибриногена и сходную с этим белком функцию: они выполняют роль стабилизирующего фактора в образовании мицеллярной структуры при свертывании молока (Fiat, Jolles, 1989;

Grosclaude, 1988; ).

Аллельный полиморфизм гена CSN3 первоначально изучался на уровне белков. В настоящее время для типирования аллелей гена CSN3 используются методы анализа полиморфизма ДНК, основанные на полимеразной цепной реакции (ПЦР). Общая длина гена CSN3 – около 13 т.п.н., основная часть однонуклеотидных замен (SNP) в белоккодирующих областях сконцентрирована в экзоне IV. У КРС описано 12 генетических вариантов гена CSN3: А, В, В2, С, Е, F, F1, G, H, I, A(1) и J (Сулимова и др., 1992; Kaminski, 1996; Prinzenberg et al. 1999). Еще один вариант (G1) выявлен у яка (Сулимова и др., 1996). Большая часть перечисленных вариантов относятся к редким и встречается у отдельных пород, как правило, с низкими частотами. А- и В-аллели гена CSN3 различаются двумя аминокислотными заменами: 136Thr(A)/Ile(B) и 148 Asp(A)/Ala(B) Grosclaude et al.,1972. Наличие треонина и аланина в положениях, соответствующих 136 и 148 по нумерации аминокислотной последовательности каппа-казеина КРС, характерно как для близкородственных видов: буйвола, зубра, яка (Сулимова и др., 1996), так и для каппа-казеинов далеко отстоящих в эволюционном отношении видов: овцы, козы, человека (Mercier et al., 1976). Только у КРС и зебу появляются А- и В-аллели каппа-казеина, у которых эти аминокислоты разнесены: 136Thr - у А-аллеля и 148Ala – у В-аллеля. Аллели А и В представлены с разными частотами у всех исследованных пород КРС.

Однонуклеотидные замены в экзоне IV гена, приводящие к аминокислотным заменам в белковой молекуле, определяют и появление или исчезновение сайтов рестрикции. В настоящее время разработано несколько методов типирования А- и В-аллелей гена CSN3 на уровне ДНК с использованием различных рестрицирующих эндонуклеаз: HinfI, HindIII, PstI, TaqI, HaeIII и MboII (Denicourt et al., 1990; Zadworny et al., 1990; Сулимова и др., 1991, 1992; Schlieben et al.,1991; Сулимова, 1998;

Гладырь и др., 2000). В международных базах данных имеются сведения о полиморфизме гена CSN3 у 23-х пород КРС (http://dga.jouy.inra.fr/cgibin/lgbc/Req_breeds.pl?BASE=cattle), однако, российские породы в этих сводках не представлены, хотя к настоящему времени полиморфизм гена CSN3 с использованием ДНК-технологий исследован, по крайней мере у 9 пород КРС отечественной селекции (Сулимова и др., 2007; Гладырь и др., 2000; Калашникова и др., 2002; Алипанах и др., 2004; Денисенко, Калашникова, 2003; Баршинова и др., 2004; Дерюшева, 1993; Матюков, 2004; Павлова и др., 2004; Хаертдинов и др., 1997; Коновалова и др., 2004) Тестирование А- и В-аллелей представляет интерес с точки зрения практики, так как молоко коров с В-аллелем каппа-казеина, имеет, по сравнению с А-аллельным вариантом, лучшую температурную устойчивость, более короткое время коагуляции, лучшую свертываемость, и содержит мицеллы различной величины, что предпочтительнее для производства сыров (Grosclaude,1988; Bringe, Kissela, 1987; Schaar et al.,1985 ). Выход сыра из молока коров с ВВ-генотипом на 10% выше, чем из молока коров с АА-генотипом (Marzali and Ng-Kwai-Hang ( 1986 )).

Наличие В-аллеля CSN3 не только способствует увеличению выхода и качества сыров, но и коррелирует с другими ценными показателями молочной продуктивности (белковостью, удойностью) (Калашникова и др., 2002;, (Grosclaude,1988; Гладырь и др., 2000). Во многих развитых странах селекция на В-аллель CSN3 включена в селекционные программы по разведению КРС (Shaar et al., 1985; Pedersen 1991). Таким образом, генотипирование гена каппа-казеина чрезвычайно важно для селекционной практики Генетически обусловленная устойчивость КРС к заболеваниям является предметом исследований многих лабораторий мира и имеет высокую практическую значимость. Гены класса II главного комплекса гистосовместимости (ГКГ), в наибольшей степени, вовлечены в ассоциации с заболеваниями. Функция антигенов класса II состоит в том, чтобы представить чужеродные белки (после внутриклеточного процессинга) T-клеткам, которые затем стимулируют соответствующий иммунный ответ (гуморального типа). Для генов класса II выявлена связь с общей резистентностью организма (Dietz et al., 1997) и устойчивостью КРС к конкретным заболеваниям, в частности к лейкозам (Xu et al., 1993).

Ген BoLA-DRB3 является ключевым геном класса II ГКГ (ген иммунного ответа), определяющим иммунный ответ организма, на вирусные и бактериальные инфекции. Методом полимеразной цепной реакции с последующим рестрикционным анализом продуктов амплификации (ПЦРПДРФ) описано 54 аллеля, а с помощью секвенирования – более 90 аллелей [http://www.ri.bbsrc.ac.uk/bola/drb3pcr.htm]. Высокий уровень полиморфизма гена BoLA-DRB3 позволяет использовать его как высокоинформативный маркер в молекулярно-генетических и филогенетических исследованиях пород и популяций.

Анализ полиморфизма гена BoLA-DRB3 у КРС представляет особый интерес, по крайней мере, по двум причинам – высокой функциональной значимостью гена (один из ключевых генов иммунного ответа организма на вирусные и бактериальные инфекции) и высоким уровнем полиморфизма. Функциональная роль аллелей гена BoLA-DRB3 различна. Выявлены аллели, ассоциированные с устойчивостью и восприимчивостью КРС к лейкозу (BoLA-DRB3.2*11, *23, *28 (номенклатура по ПДРФ) и BoLA-DRB3.2*8, *16, *22, *24 соответственно) (Xu et al., 1993; Сулимова и др., 1995; Удина и др., 2003), маститу, вызываемому Staphylococcus sp. (Alizadeh et al., 2003; Sharif et al., 1998;

Kulberg et al., 2007), заболеваниям яичников (Sharif et al., 1998), молочной лихорадке (Sharif et al., 1998) и другим заболеваниям (Maillard et al., 1996; Lewin et al., 1999). Были также выявлены ассоциации полиморфных вариантов гена BoLA-DRB3 с признаками молочной продуктивности (Starkenburg et al., 1997), что, возможно, объясняется тесным физическим сцеплением BoLA-комплекса с геном пролактина (Lewin et al., 1999 ).

Аллельный полиморфизм гена BoLA-DRB3 исследован у различных пород КРС: голштинской (Kelm et al., 1997; Sharif et al., 1998;

Ledwidge et al., 2001; Miretti et al., 2001; (Nassiry et al., 2005), джерсейской (Gilliespie et al., 1999; Sharif et al., 1998; Miretti et al., 2001), черно-пестрой (Сулимова и др., 1995; Удина и др., 1998), айрширской (Удина и др., 1998, 2003) пород, российских пород: ярославской и красной горбатовской (Сулимова, 2006), якутской и калмыцкой (Рузина и др., 2010), монгольского скота (Рузина и др., 2010), иранского скота Систани (Мохаммади и др., 2009) и других.

2.3 Материалы и методы

Исследования проводили на выборках коров костромской породы из ГОУП ПЗ «Лужки» (n=62), СПК «Гридино» (n = 42) и ОПХ «Минское»

(n= 20) и быков костромской породы: чистопородных (n = 24) и помесных (n = 23) (с прилитием швицкой крови от 1/8 до 1/2) из ОАО «Костромское» по племенной работе.

1. Выделение ДНК.

Выделение ДНК проводили с использованием набора «DIAtomTMDNAPrep200» фирмы «Isogene lab.», Россия, согласно прописи, предоставленной производителем. Принцип действия набора основан на использовании лизирующего реагента с гуанидинтиоционатом, который предназначен для лизиса клеток, солюбилизации клеточного дебриса, а так же для денатурации клеточных нуклеаз. В присутствии лизирующего реагента ДНК активно сорбируется на NucleoSTM-сорбенете, затем легко отмывается от белков и солей спиртовым раствором. ДНК, элюированная из сорбента ЭкстраГеномTM, может быть напрямую использована по назначению.

ДНК выделяли из 200 мкл цельной крови. Для этого к образцу добавляли 800 мкл лизирующего реагента (5 M гуанидинтиоцианат, 20 мМ ЭДТА, 100мМ Tris-HCl, pH 6,4 и 1% тритон X-100), перемешивали пробирку переворачиванием 5-10 раз, термостатировали 5-7 мин. при температуре 65оС (термостат Termo 24-15, «Биоком», Россия). После термостатирования центрифугировали пробирку 10 сек. при 5000 об/мин на настольной центрифуге (Centrifuge 5415R, «Eppendorf»), Германия, прозрачный супернатант переносили в чистую пробирку. К полученной смеси добавляли 40 мкл суспензии сорбента NucleoSTM (специально обработанные стеклянные шарики определенного размера), предварительно перемешанной до гомогенной суспензии на вортексе.

Пробирку помещали на ротатор («MiniBio RS-24», «BioSan», Латвия), перемешивали ее содержимое 10 мин при 20 об/мин, затем центрифугировали 10 секунд при 5000 об/мин. Супернатант удаляли с помощью водоструйного насоса. К осадку добавляли 400 мкл лизирующего реагента и 1 мл солевого буфера. 1х солевой буфер готовили из 10х солевого буфера (1М NaCl и 1M KCl). Для этого 10 мл 10х солевого буфера переносили в мерный цилиндр, доводили бидистиллированной водой до метки 100 мл, и 96% этиловым спиртом до метки 300 мл. Перемешивали содержимое пробирки переворачиванием 5раз, центрифугировали 10 сек при 5000 об/мин, удаляли супернатант.

Затем к осадку довавляли 1 мл солевого буфера, перемешивали содержимое пробирки на вортексе («Microspin FV-2400», «BioSan», Латвия), центрифугировали 10 сек при 5000 об/мин, удаляли супернатант с помощью водоструйного насоса. Эти операции проделывали дважды.

После этого сушили осадок при 65оС в течение 5 мин. В каждую пробирку вносили 100-200 мкл ЭкстраГенаTM (10% смесь ионообменников (типа Chelex), и 0,01% тритон X-100). Перемешивали сожержимое пробирки на вортексе 5-10 сек до получения гомогенной суспензии, после чего термостатировали 5 мин при 65оС. Еще раз суспендировали смесь на вортексе и центрифугировали 1 мин при 10000 об/мин. Супернатант с ДНК переносили в чистую пробирку.

ДНК, выделенная таким образом из свежего биологического материала, является высокомолекулярной (40-50 тыс.п.н.) и чистой (OD260/280 нм =1,6-2,0). Выход ДНК из цельной крови составляет 5-10 мкг из 200 мкл крови.

В ряде случаев для выделения ДНК использовали набор «MagnaTMDNAPrep200». Принцип действия набора такой же, как у «DIAtomTMDNAPrep200». Отличие набора заключается в использовании Magnetic-сорбента (активированные стеклянные шарики размером 1-25 мкм, с намагниченной сердцевиной). Для работы с набором требуется магнитный штатив. В присутствии лизирующего реагента ДНК собирается на сорбенте, затем легко отмывается от белков и солей спиртовым раствором. Протокол использования набора такой же, как и «DIAtomTMDNAPrep200».

для Использование магнитного штатива позволяет пропустить стадии центрифугирования смеси перед удалением супернатанта. Полученная ДНК может быть использована по назначению без дополнительной очистки или другой обработки.

Выделение ДНК проводили в изолированной комнате под ламинаром с использованием отдельного набора пипеток с целью предотвращения загрязнения образцов чужеродной ДНК.

2. Определение концентрации ДНК.

Концентрацию ДНК определяли визуально после электрофоретического разделения в агарозном геле. На 1% агарозный гель («Agarose, Biotechnology grade», «Helicon», Россия) наносили ДНК фага в количестве 25, 50, 100 нг и аликвоты из раствора с неизвестной концентрацией. Электофорез проводили в 1х трис-боратном (TBE) буфере (89мM Tris-OH, 89мM H3BO3, 2 мM EDTA) с добавлением в гель бромистого этидия (1 мкг/мл) для окрашивания ДНК, при постоянном напряжении 120В. Для предотвращения контаминации электрофорез проводили в отдельной комнате. Гели анализировали под ультрафиолетовыми лучами на трансиллюминаторе «UVT», «Биоком», Россия, и фотографировали с помощью гель-документирующей системы «MINITRON». Концентрации ДНК исследуемых образцов определяли, сравнивая интенсивность флуоресценции аликвот из растворов с неизвестной концентрацией и контрольной раститровки ДНК фага.

3. Анализ полиморфизма генов пролактина, гормона роста и каппаказеина Сбор инкубационной смеси проводили в стерильных условиях под ламинаром. Полимеразную цепную реакцию проводили в объеме 25 мкл в реакционной смеси, содержащей буфер для амплификации (67 мМ трисHCl (pH 8,8), 16 мМ (NH4)2SO4 0,1% Tween 20), смесь dNTP (содержащую 2мМ каждого нуклеотида), 2,5 мМ MgCl2, 100 нг смеси праймеров, 50-100 нг геномной ДНК, 1 ед. активности Taq-полимеразы. Амплификацию проводили в термоциклере PTC-100 фирмы MJ Research (США). B одну пробу не добавляли ДНК, она являлась отрицательным (-) - контролем. Ha основе имеющейся нуклеотидной последовательности праймеров и их концентрации в о.е./мл проводили перерасчет концентрации на нг/мкл с помощью программы "Oligo" и рассчитывали количество праймеров (в мкл), которое необходимо было добавлять в инкубационную смесь.

Полимеразную цепную реакцию во всех случая проводили по одной схеме, за исключением температуры отжига, которую для каждой пары праймеров определяли с помощью программ "Oligo" и "Primer" и затем уточняли экспериментальным путем (см.

таблицу 2.1):

Предварительная денатурация - 940C - 4 мин.

Денатурация - 940C - 45 сек Отжиг - (см. таблицу 1) - 45 сек Синтез - 720C - 45 сек 30 циклов Заключительный синтез - 720C - 7 мин Количество циклов амплификации - 30-35. Для предотвращения загрязнения помещения продуктами амплификации, их анализ проводился в комнате для проведения электрофореза.

–  –  –

амплификации (метод ПЦР-ПДРФ) и аллель-специфичная ПЦР.

Рестрикционный анализ каждого продукта амплификации (10 мкл) проводили в стандартных условиях с использованием двух независимых рестрицирующих эндонуклеаз TaqI (при 650С) и HinfI (при 370C).

Продукты рестрикции разделяли в 6%-ном полиакриламидном геле, окрашивали этидий бромидом и регистрировали с помощью системы Vitran (Биоком, Москва). Аллель-специфичную ПЦР проводили с использованием набора "GenePak k-Casein A/B PCR test" (IsoGene, Москва) согласно прописи изготовителя с последующим электрофоретическим разделением продуктов амплификации в 2%-ном геле агарозы в присутствии этидий бромида. Фрагменты ДНК регистрировали с помощью системы Vitran (Биоком, Москва). B качестве маркеров молекулярных весов использовали MspI-рестриктные фрагменты плазмиды pBR322 или маркер М50 (IsoGene, Москва).

Полиморфизм гена пролактина исследовали с помощью метода ПЦР-ПДРФ с использованием рестриктазы RsaI (Mitra et al., 1995).

Полиморфизм гена гормона роста изучали методом ПЦР-ПДРФ с использованием рестриктаз MspI и AluI (Mitra et al., 1995).

4. Анализ полиморфизма гена BoLA-DRB3 методом ПЦР-ПДРФ.

Амплификацию участка экзона 2 гена BoLA-DRB3 размером 284 п.н.

(281 п.н. для аллелей с делецией) проводили методом гнездовой ПЦР. ПЦР проводили с использованием готовых наборов «GenPakR PCR Core», «IsoGene lab.», Россия. Конечный обем реакционной смеси составил 20 мкл.

Смесь содержала 60 мM Tris-HCL (pH 8,8), 2,5 мM MgCl2, 20 мM KCL, 15 мM (NH4)2SO4, 10 мM меркаптоэтанола, 0,1% тритона Х-100; 0,2 мM дНТФ, 10 ед. Klentaq ДНК-полимеразы, по 10 пM каждого праймера, матричную ДНК. На инкубационную смесь наслаивалась капля минерального масла (30мкл) для предотвращения испарения смеси. Для первого раунда реакции использовали праймеры HLO-30 (5’-3’: TCCTCTCTCTGCAGCACATTTCC) и HLO-31 (5’-3’: ATTCGCGCTCACCTCGCCGCT). В качестве матрицы использовали 5 мкл ДНК, независимо от ее концентрации.

Для второго раунда ПЦР использовали праймеры HLO-30 (5’-3’:

TCCTCTCTCTGCAGCACATTTCC) и HLO-32 (5’-3’:

TCGCCGCTGCACAGTGAAACTCTC). Матрицей служили 2 мкл продуктов ПЦР первого раунда. Для избежания загрязнения сбор реакционной смеси для всех видов анализа проводили в отдельной комнате с использованием индивидуального комплекта пипеток. Параметры амплификации указаны в таблице 2.2. ПЦР проводили в многоканальном амплификаторе «Терцик»

фирмы «ДНК-технология», Россия.

–  –  –

После второго раунда гнездовой ПЦР проводили электрофорез в 1,8% агарозе для оценки качества и концентрации полученного фрагмента. На гель наносили не более 3 мкл образца. Условия электрофореза аналогичны п.3.2. Для оценки длин фрагментов использовали маркер «М50» фирмы «IsoGene lab.», Россия.

Для рестрикционного анализа продуктов амплификации фрагмента экзона 2 гена BoLA-DRB3 использовали эндонуклеазы рестрикции RsaI, HaeIII XhoII фирм «Promega», США, «New England BioLabs», США или НПО «СибЭнзим», Россия. Для анализа брали 7 мкл продуктов ПЦР второго раунда. Количество фермента на 1 реакцию - 5 ед активности. Инкубацию проводили в течение 12 часов.

Рестрикционные фрагменты разделяли с помощью электрофореза а 4% агарозном геле. Гель готовили из агарозы «TopVisionTM LE GQ» фирмы «Fermentas», Литва. На гель наносили весь объем инкубационной смеси. Условия электрофореза см. в п.3.2. Для оценки длины фрагментов использовали маркер молекулярных весов «GeneRuler™ Ultra Low Range DNA Ladder» фирмы «Fermentas», Литва.

Аллельные варианты гена BoLA-DRB3 определяли на основе паттернов рестрикции в соответствии с принятыми стандартами (http://www.projects.roslin.ac.uk/bola/bolahome.html).

5. Статистическая обработка данных.

В данной работе для подсчета частот аллелей использовали следующую формулу:

–  –  –

, где где p – частота исследуемого аллеля, q = 1 – р, n – объем выборки (Рокицкий, 1961).

Для сравнения выборок использовали критерий Стьюдента для качественных признаков:

,

–  –  –

, где Ho - наблюдаемая гетерозиготность, He - ожидаемая гетерозиготность.

В работе были использованы следующие компьютерные программы:

1) программы “Oligo” и “Primer” для подбора праймеров, расчета концентрации праймеров и расчета температуры отжига;

2) программы «Statistika» и «Popgene» для статистической обработки данных и поиска ассоциативных связей;

В работе были использованы компьютерные базы данных, представленные на сервере NCBI – Национальный центр информации по биотехнологии (http://www.ncbi.nlm.nih.gov/).

2.4 Результаты и их обсуждение

Оценку генетического потенциала костромской породы по генам, ответственным за молочную продуктивность, проводили по генам CSN3, bPRL и bGH. Каппа-казеин – один из основных белков молока, он составляет около 13% от всех белков молока, участвует в стабилизации мицелл при свертывании молока. Тестирование A- и B-аллелей гена представляет практический интерес, поскольку молоко, содержащее Bаллель каппа-казеина, предпочтительнее для производства сыров (более высокий выход творога и сыра, получение твердых сыров). Гормон роста и пролактин – полипептидные гормоны, играющие важную роль в регуляции лактации и других процессах. Аллели генов могут быть связаны с положительным или отрицательным воздействием на молочную продуктивность. У ряда пород КРС LL генотип гена bGH ассоциирован с высокими удоями, содержанием жира и белка в молоке, а АА генотип гена bRPL – с высоким содержанием жира и белка (Хатами и др., 2005; Chung et al., 1996; Alipanah et al., 2007).

Учитывая распределение полиморфных сайтов рестрикции, позволяющих тестировать аллельные варианты гена CSN3, нами был выбран для амплификации in vitro участок гена длиной 228 п.н., расположенный в экзоне IV. Данный участок гена кодирует аминокислотную последовательность с 103 аминокислоты до конца пептида, частично захватывая 3’-нетранслируемую область (праймер SGO расположен в 3’- области сразу после стоп-кодона) и содержит полиморфные сайты рестрикции для четырех эндонуклеаз: TaqI и HindIII - у аллеля В и HinfI и PstI - у аллеля А. Наличие полиморфных сайтов рестрикции для нескольких рестриктаз обеспечивает возможность типирования А- и В-аллелей каппа-казеина методом ПЦР-ПДРФ. Однако, аллель-специфичная ПЦР позволяет более четко тестировать гетерозиготы и, кроме того, этот метод является более простым, быстрым и экономичным. Поэтому в данном исследовании были использованы оба подхода. Пример типирования аллелей гена CSN3 с помощью аллель-специфичной ПЦР приведен на рис. 2.1. Из рисунка видно, что аллель-специфичная ПЦР действительно позволяет четко тестировать как гомозиготы, так и гетерозиготы.

Риунок 2.1 - Типирование аллелей гена каппа-казеина с помощью аллель-специфичной ПЦР с последующим разделением продуктов в 2%ном геле агарозы у животных костромской породы из ОПХ «Минское» и СПК «Гридино».

Номера образцов ДНК указаны сверху, три дорожки слева – контрольные образцы: гомозиготы АА и ВВ и гетерозигота по гену каппа-казеина.

Полиморфизм всех других генов определяли методом ПЦР-ПДРФ.

Примеры рестрикционного анализа генов bGH и bPRL приведены на рис.

2.2 и 2.3 соответственно.

Рисунок 2.2 - Электрофореграмма в 6%-ом полиакриламидном геле AluI-продуктов рестрикции фрагмента экзона 4 гена bGH.

Дорожки: 1 – маркер молекулярных весов (pBR 322/MspI), 2, 5, 8 – гомозиготы L/L, 3, 4, 6 - гетерозиготы V/L, 7, 9 – гомозиготы V/V.

Рисунок 2.3 - Электрофореграмма в 6%-ом полиакриламидном геле RsaIпродуктов рестрикции исследуемого фрагмента гена bPRL.

Дорожки: 1, 2, 3, 5 и 6 – гомозиготы АА, 7 - гетерозигота АВ, 4 – маркер молекулярных весов (pBR 322/MspI).

Частоты аллелей и генотипов исследуемых генов в выборках костромской породы КРС из различных хозяйств а также значения наблюдаемой и ожидаемой гетерозиготности и другие параметры представлены в табл. 2.3.

–  –  –

По трём исследованным генам в костромской породе достоверных отличий, по величинам наблюдаемой и ожидаемой гетерозиготности выявлено не было. Однако для отдельных хозяйств было показано достоверное отличие наблюдаемого распределения генотипов от ожидаемого. Два хозяйства ОАО «Минское» и СПК «Гридино» по уровню гетерозиготности по двум генам CSN3 и bPRL резко отличались друг от друга. Так в хозяйстве ОАО “Минское” отмечен избыток гетерозигот (для гена CSN3 D = 0,128, а для гена bPRL D = 0,148), в то время как в хозяйстве СПС “Гридино” наблюдается недостаток гетерозигот (для гена CSN3 D = -0,307, а для гена bPRL D = -0,034). При этом в целом в костромской породе уровень гетерозиготности соответствует ожидаемому.

Количество животных, содержащих в своем генотипе B-аллель гена CSN3 (животные с генотипами АВ и ВВ), в целом по породе составляет 62,4%, причём в СПК «Гридино» эта величина достигает 76,2%. Выборка КРС из СПК «Гридино» достоверно отличается по частоте генотипа ВВ от частот данного генотипа в других хозяйствах (t d = 3,614-4,069, р0,001). Таким образом, более ценный В-аллель гена каппаказеина наиболее широко представлен в стаде костромской породы из СПК «Гридино». Частота В-аллеля гена CSN3 в этом стаде превышает таковую у других отечественных пород КРС, включая ярославскую породу, исследованную нами ранее (частота В-аллеля составила в среднем по двум хозяйствам (0,475, n=120).

В целом, костромская порода КРС имеет высокий уровень содержания В-аллеля каппа-казеина и молоко коров костромской породы может быть с успехом использовано в сыродельческой промышленности.

Ранее выявлена положительная связь AA и AB генотипов по RsaIмаркеру гена bPRL с удоем и процентным содержанием белка в молоке (Chung et al. 1996; Хатами и др. 2005; Alipanah et al., 2007). Суммарная частота генотипов АА и АВ гена bPRL у костромской породы в целом составляет 58,96%, причём в СПК «Гридино» их частота достигает 88,1%.

По данным ряда авторов, LL генотип гена bGH ассоциирован с высокими удоями коров, более высоким содержанием жира и белка в молоке по сравнению с VL и VV генотипами (Chung et al. 1996; Хатами и др. 2005; Alipanah et al., 2007. У костромской породы КРС преобладающим генотипом по AluI-маркеру гена bGH является генотип L/L – от 73,8% до 95,0% (табл.3). Это самое высокое содержание этого ценного генотипа среди отечественных пород КРС.

Следует отметить, что LL генотип гена bGH ассоциирован не только с высокими удоями коров и более высоким содержанием жира и белка в молоке, но и с большим приростом массы тела по сравнению с VL генотипом. Как уже отмечалось выше, костромская порода характеризуется высокой частотой LL генотипа гена bGH в исследованных стадах костромского скота, что указывает на возможность использования костромской породы в направлении мясной продуктивности.

Ранее было показано, что основная роль в иммунном ответе организма на вирусные и бактериальные инфекции принадлежит гену BoLA-DRB3. Методом ПЦР-ПДРФ тестировано 54 аллеля гена BoLADRB3. Выявлены BoLA-DRB3 аллели, определяющие устойчивость и восприимчивость КРС к лейкозу (Xu et al., 1993; Сулимова и др., 1995).

Проведено тестирование животных костромской породы по гену BoLADRB3 и определены частоты аллелей (табл. 2.4).

Тестирование коров костромской породы показало, что суммарная частота аллелей гена BoLA-DRB3, определяющих устойчивость к лейкозу, составила в целом по породе - 35,9%; ассоциированных с восприимчивостью к лейкозу – 4,0% (табл. 2.4, рис. 2.4).

–  –  –

Следует отметить, что аллели BoLA-DRB3.2*7 и *11 по данным ряда авторов (Kulberg et al., 2007) оказывают положительный эффект на устойчивость КРС к клиническому маститу. Суммарная частота этих аллелей у костромской породы также достаточно высокая – 24,1%.

Полученные данные указывают, что костромская порода имеет высокий генетический потенциал устойчивости к заболеваниям, в частности к лейкозу КРС и клиническому маститу.

–  –  –

*51 ; 0,0625 *7 ; 0,0625 *37 ; 0,0181 *43 ; 0,0091 *7 ; 0,1455 *49 ; 0,05 *11 ; 0,1 *48 ; 0,0375 *36 ; 0,2092 *41 ; 0,05 *11 ; 0,1182 *36 ; 0,0375 *13 ; 0,0125 *31 ; 0,0181 *12 ; 0,0125 *25 ; 0,0091 *28 ; 0,2 *20 ; 0,0545 *28 ; 0,0636 *18 ; 0,0091 *8 ; 0,0091 *17 ; 0,0091 *15 ; 0,0454 *10 ; 0,2125 *8 ; 0,0375 *12 ; 0,0181 *22 ; 0,0375 *10 ; 0,2638 *1 ; 0,0875

–  –  –

*49 ; 0,01755 *41 ; 0,05264 *51 ; 0,0222 *48 ; 0,01317 *7 ; 0,13157 *37 ; 0,05264 *43 ; 0,00441 *7 ; 0,114 *41 ; 0,02611 *36 ; 0,02631 *37 ; 0,01755 *20 ; 0,02631 *36 ; 0,11829 *11 ; 0,12705 *12 ; 0,10526 *31 ; 0,00879 *11 ; 0,21053 *25; 0,00441 *20 ; 0,03069 *18 ; 0,00441 *17 ; 0,00441 *15 ; 0,0222 *10 ; 0,07895 *28 ; 0,11829 *13 ; 0,00441 *12 ; 0,03069 *8 ; 0,01755 *22 ; 0,0222 *28 ; 0,10526 *1 ; 0,15789 *1 ; 0,05697 *10 ; 0,21465 *22 ; 0,05264

–  –  –

Таким образом, костромская порода характеризуется высоким содержанием хозяйственно-ценных аллелей и генотипов:

- В-аллеля каппа-казеина (до 59,5%, в целом по породе), определяющего сыродельческие качества молока;

- генотипа L/L по гену гормона роста (до 95%), ассоциированного с высоким содержанием жира и белка в молоке и большим приростом массы тела;

- генотипа АА по гену пролактина (до 73,7%), ассоциированного с высоким содержанием белка в молоке;

- аллелей гена BoLA-DRB3, определяющих устойчивость к лейкозу (до 44,8%, в целом по породе - 36%) и клиническому маститу (до 34,3%, в целом по породе - 24,1%).

Уникальность костромской породы заключается в редком сочетании ценных генетических комплексов, одновременно обеспечивающих высокое качество молока и мяса, а также высокий уровень устойчивости к заболеваниям. Генетический потенциал костромской породы не исчерпан. Она является одной из лучших отечественных пород и нуждается в бережном отношении к сохранению ее уникальности и дальнейшему усовершенствованию.

3 РАЗРАБОТКА И ИССЛЕДОВАНИЕ

АВТОМАТИЗИРОВАННОЙ СИСТЕМЫ УПРАВЛЕНИЯ

ТЕХНОЛОГИЧЕСКИМ ПРОЦЕССОМ ПОДРАБОТКИ

ЗЕРНОВЫХ КОЛОСОВЫХ КУЛЬТУР МЕТОДОМ

ТЕРМОДИНАМИЧЕСКОГО ВОЗДЕЙСТВИЯ

3.1 Автоматизированные и автоматические системы управления технологическим процессом Управление – это совокупность действий, направленных на поддержание функционирования объекта в соответствии с заданной программой, или на основе определенной информации о значении параметров управляемого объекта [3.1].

С точки зрения автоматизации производства управление подразделяется на ручное, полуавтоматическое и автоматическое [3.1].

Классификация систем автоматического управления приведена на рис.

3.1.

Рисунок 3.1 – Классификация систем автоматического управления При автоматическом управлении подача команд на управляемый объект осуществляется от специальных устройств либо по заданной программе, либо на основании информации контролируемых параметров.

В следящих системах осуществляется регулирование одного параметра в зависимости от значения другого параметра. Например, в шахтной аэрожёлобной сушилке при отклонении толщины зернового слоя автоматически увеличивается или уменьшается частота вращения вала выгрузного дозатора, уменьшается или увеличивается подача материала из норий.

При полуавтоматическом (автоматизированном) управлении контроль работы управляемого объекта и подача команд осуществляется частично оператором.

В зависимости от функций, выполняемых автоматическими устройствами, различают следующие основные виды автоматизации:

автоматический контроль, автоматическую защиту, автоматическое управление, телемеханическое управление [3.2].

Автоматический контроль включает в себя автоматические сигнализацию, измерение, сортировку и сбор информации.

Важнейшей частью автоматизации любого процесса является автоматический контроль его параметров. Эти системы позволяют освободить человека от наблюдения за технологическим процессом, состоянием различных устройств, механизмов и систем или облегчить эту работу.

Системы автоматического контроля с помощью датчиков собирают следующую информацию:

• количественную оценку физико-химических свойств твёрдых тел, жидкостей, газов (давление, плотность, вязкость, температура, влажность, концентрация примесей и т.д.);

• определение геометрических размеров деталей в процессе и после обработки, поиск дефектов структуры изделий; оценка качества сборочных и других работ с целью вовремя обнаружить брак и предотвратить потери и т.п.

Данные выводятся в удобной форме на общий пульт управления, где оператор может их видеть и принимать решение.

Кроме этого, при отклонении параметров от заданных значений система сигнализирует об этом звуковыми и световыми сигналами. В основном это диспетчерские системы.

В задачу системы автоматической сигнализации входит оповещение обслуживающего персонала о ходе технологического процесса, о возникновении опасности, об аварийных режимах работы оборудования, требующих принятия неотложных мер. Виды сигналов зависят от степени опасности. При поступлении сигналов о наиболее опасных недопустимых режимах для привлечения внимания обслуживающего персонала, как правило, применяются прерывистые звуковые сигналы, яркие вспышки ламп, звонки, сирены.

Схемы технологической сигнализации Схемы технологической сигнализации предназначены для оповещения обслуживающего персонала о нарушении нормального хода технологического процесса. Технологическая сигнализация воспроизводится ровным и мигающим светом и сопровождается, как правило, звуковым сигналом.

Сигнализация по назначению может быть предупреждающей и аварийной. Такое разделение обеспечивает различную реакцию обслуживающего персонала на характер сигнала, определяющего ту или иную степень нарушения технологического процесса.

Наибольшее применение нашли схемы технологической сигнализации с центральным съемом звукового сигнала. Они дают возможность принимать новый звуковой сигнал до размыкания контактов, вызвавших появление предыдущего сигнала. Использование различной релейной и сигнальной аппаратуры, различного напряжения и рода тока практически не меняет принципа действия схем.

Технологические процессы требуют позиционного контроля большого числа параметров, а характерной особенностью схем технологической сигнализации является наличие общих схемных узлов, в которых перерабатывается информация, поступающая от многих двухпозиционных технологических датчиков.

Информация из этих узлов выдается в форме звукового и светового сигналов только о тех параметрах, значения которых вышли из нормы или необходимы для управления технологическим процессом.

Благодаря общим узлам, снижаются потребность в аппаратуре и затраты на автоматизацию производства.

В зависимости от числа сигнализируемых параметров световая сигнализация может быть выполнена ровным или мигающим светом. При сигнализации многих параметров (более 30) применяются схемы с миганием поступившего сигнала. Если число параметров менее 30, применяют схемы с ровным светом.

Алгоритм работы схем технологической сигнализации в большинстве случаев одинаков: при отклонении параметра от заданного значения или сверхдопустимого подаются звуковой и световой сигналы, звуковой сигнал снимают кнопкой съема звукового сигнала, световой сигнал исчезает при уменьшении отклонения параметра от допустимого значения. Пример схемы технологической сигнализации с разделительными диодами и мигающим светом приведен на рис. 3.2.

Здесь ЛКН – лампа контроля напряжения, Зв – звонок, РПС – реле предупреждающей сигнализации, РП1-РПn – промежуточные реле индивидуальных сигналов, включаемые контактами датчиков Д1 - Дn технологического контроля, ЛС1 - ЛСn – индивидуальные лампы, 1Д1Дn, 2Д1-2Дn – развязывающие диоды, КОС – кнопка опробования сигналов, КСС – кнопка съема сигналов, ШРС – шина ровного света, ШМС – шина мигающего света.

–  –  –

РПП2 Д1 Д2 РПП1 РПМ РПС Д3 Д4 РПП2 РПП1 3 7 11 РПП1 5 9 13

–  –  –

Схемы технологической сигнализации с зависимым звуковым сигналом от светового применяют только для предупреждающей сигнализации состояния неответственных технологических параметров, так как в этих схемах возможна потеря сигнала, если сигнальная лампа неисправна.

Могут встретиться схемы технологической сигнализации с индивидуальным съемом звукового сигнала. Схемы строят с использованием для каждого сигнала самостоятельного ключа, кнопки или другого коммутационного аппарата, отключающего звуковой сигнал, и применяют для сигнализации состояния отдельных агрегатов.

Одновременно со звуковым сигналом отключается и световой.

Автоматическая защита представляет собой совокупность технических средств, которые при возникновении ненормальных или аварийных режимов либо прекращают контролируемый производственный процесс, либо устраняют эти ненормальные условия.

Для дополнительного оповещения работников автоматические системы защиты подают сигналы обслуживающему персоналу об аварийных режимах работы оборудования. Автоматическая защита применяется повсеместно в промышленности и в быту, на транспорте и в энергетике. Автоматические системы играют важную роль в обеспечении безопасности, не только производства, но и для работающих на предприятиях сотрудников и населения ближайших территорий. Системы аварийной защиты таких объектов, как атомный реактор, играют важную роль и значение для безопасности уже в масштабе не только одной страны, а нескольких. Эти системы имеют автономное питание, собственные датчики, и исполнительные механизмы. От них требуется высокие быстродействие и надежность. Для повышения надежности системы делаются многоканальными, т.е. функции дублируются.

Наиболее часто в современных сушильных машинах применяются автоблокировки – вид автоматической защиты, предназначенный для неправильных включений и отключений и других ошибок обслуживающего персонала.

Автоматическое управление включает в себя комплекс технических средств и методов воздействия на объект без участия обслуживающего персонала. Сочетание комплекса технических устройств с объектом управления называют системой автоматического управления (САУ). Разновидность автоматического управления – автоматическое регулирование, под которым понимают процесс поддержания какого либо параметра на заданном уровне или изменение его по определенному закону. Автоматическое регулирование осуществляют автоматическим регулятором. Автоматическая система, состоящая из регулятора и объекта управления, называется системой автоматического регулирования (САР).

Телемеханическое управление включает в себя управление с применением телемеханики. Телемеханика – область науки и техники, охватывающая теорию и технические средства автоматической передачи на расстояние команд управления и информации о состоянии объекта.

Телемеханика позволяет объединить в один технологический процесс работу большого числа машин и установок, находящихся на значительном расстоянии друг от друга.

Особое значение телемеханика приобретает в связи с созданием автоматизированных систем управления (АСУ). Обработка данных, полученных по каналам телемеханики, на ЭВМ позволяет значительно улучшить контроль за технологическим процессом и упростить управление. Поэтому в настоящее время вместо понятия «телемеханика»

всё чаще и чаще используется сокращение АСУТП — автоматизированная система управления технологическим процессом.

Современная система телемеханики также немыслима без компьютера, поэтому можно сказать, что телемеханика и АСУТП — близнецы-братья.

Разница между этими понятиями улавливается лишь по времени появления и по традиции использования. Например, в энергетике предпочитают использовать слово телемеханика, на промышленных предприятиях — АСУТП.

Тенденции развития телемеханики В современной системе телемеханики большое внимание уделяется программному обеспечению системы и интеграции с действующими системами и программными комплексами. Стандартом стало графическое представление схем контролируемого процесса (мнемосхем) с «живым» отображением текущего состояния, управление объектом с кадров мнемосхем.

В программном обеспечении наблюдается тенденция к стандартизации программных интерфейсов систем сбора данных и обрабатывающих программ (технология OPC), возрастает потребность экспорта собранных данных в специализированные программы (расчета режимов, планирования, аналитические, АРМ специалистов). В условиях усложнения систем повышается роль средств диагностики и отладки.

С технической стороны в системах всё чаще используются современные скоростные каналы связи (оптоволокно, Ethernet) и беспроводные технологии (например, транкинговая и сотовая связь).

Вместе с тем сохраняется потребность стыковки с морально (а иногда и физически) устаревшими «унаследованными» системами, с сохранением их протоколов связи. На контролируемых объектах всё чаще возникает необходимость стыковки с локальными технологическими системами.

Наряду с усложнением самих систем и их программного обеспечения наблюдается изменение требований к реализуемым функциям. К традиционным функциям телемеханики (телесигнализация, телеизмерение, телеуправление) добавляются функции энергоучёта, транспорта данных с локальных автоматических приборов. К обычным функциям контроля за изменением состояния и превышения предельных значений добавляются возможности текущих расчётов и логического анализа (например, балансные расчёты).

3.2 Обзор существующих систем управления технологическим процессом сушки зерновых колосовых культур Сушка сельскохозяйственных материалов – это процесс, характеризующийся в каждый момент времени совокупностью показателей, которые отражают физическое состояние управляемого объекта. Эти показатели могут изменяться или оставаться неизменными при изменении внешних условий и режимов работы управляемого устройства и являются параметрами управляемого процесса.

Автоматизация управления повышает культуру эксплуатации и КПД сушильной установки, увеличивает её производительность, улучшает качество сушки, повышает надёжность работы, облегчает условия труда и позволяет уменьшить количество обслуживающего сушилку персонала Рассмотрим имеющиеся системы автоматизации технологического процесса сушки зерносушилок.

Автоматизация шахтной сушилки рассмотрим на примере сушилки СЗШ-16 [3.2]. Сушилка состоит из двух параллельно расположенных шахт, двух охладительных камер, вентиляторов и воздуховодов (рис. 3.4). Загрузка сырого зерна и перегрузка пересушенного в охладительные камеры обеспечивается работой четырех норий. Шахта сушилки состоит из двух секций, поставленных одна на другую. Внутри шахты расположено 14 рядов по 8 коробов в каждом ряду. К наружным стенкам шахты присоединяют всасывающие воздуховоды вентиляторов, подача сушильного агента производится в диффузор, образованный пространством между шахтами. Над каждой шахтой установлен надсушильный бункер, излишек из которого ссыпается в бункер нории для сырого зерна.

–  –  –

Зерно из шахт выпускают посредством непрерывно действующего устройства через 8 лотков. Охладительная камера состоит из двух вертикальных цилиндров с перфорированными стенками и конусным дном шлюзового затвора и вентилятора.

Все сушилки отличаются от прочих объектов управления большим количеством входных и выходных параметров и сложностью связей между ними (рис. 3.4).

Основные выходные параметры процесса – влажность и температура на выходе из сушилки, а также некоторый показатель Э, характеризующий работу зерносушилки. К числу параметров, непосредственно влияющих на регулируемые параметры, относят также температуру сушильного агента.

В качестве регулирующих воздействий используют изменение подачи топлива и зерна. Остальные входные параметры, в том числе начальные влажность и температура зерна, расход сушильного агента и его влажность, относятся к группе возмущающих воздействий.

Шахтная сушилка, как объект автоматизации, характеризуется сложной системой взаимных связей между выходными, регулирующими и возмущающими воздействиями и регулируемыми параметрами.



Pages:   || 2 | 3 |
Похожие работы:

«РЯБОВ ВЯЧЕСЛАВ АЛЕКСАНДРОВИЧ АКУСТИЧЕСКИЕ СИГНАЛЫ, СЛУХ И ЭХОЛОКАЦИОННАЯ СИСТЕМА ДЕЛЬФИНА 03.01.02 биофизика Диссертация на соискание ученой степени доктора физико-математических наук Научный консультант: д.б.н., профессор Токарев Юрий Николаевич С-Петербург 2016   ОГЛАВЛЕНИЕ Стр. ВВЕДЕНИЕ РАЗДЕЛ 1. ОБЗОР ЛИТЕРАТУРЫ. 1.1. Характеристики акустичес...»

«СИДОРОВА ТАТЬЯНА АЛЕКСАНДРОВНА ОСОБЕННОСТИ АДАПТИВНЫХ РЕАКЦИЙ У ДЕВУШЕК К УСЛОВИЯМ ГОРОДСКОЙ СРЕДЫ 03.02.08 Экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель: доктор биологических наук, доцент Драгич О.А. Омск-2015 СОДЕРЖАНИЕ Введение.. 3 Глава 1 Обзор литерат...»

«МИНИСТЕРСТВО ОХРАНЫ ЗДОРОВЬЯ УКРАИНЫ ЗАПОРОЖСКИЙ ГОСУДАРСТВЕННЫЙ МЕДИЦИНСКИЙ УНИВЕРСИТЕТ Кафедра медицинской биологии, паразитологи и генетики ПОПУЛЯЦИОННО-ВИДОВОЙ, БИОГЕОЦЕНОТИЧЕСКИЙ И БИОСФЕРНЫЙ УРОВНИ ОРГАНИЗАЦИИ ЖИЗНИ УЧЕБНО-МЕТОДИЧЕСКОЕ ПОСОБИЕ по медицинской биологии и паразитологии для студен...»

«Утвержден общим собранием акционеров ОАО «АК БАРС» БАНК (Протокол № 16/29-05-15 от 03.06.2015г.) ГОДОВОЙ ОТЧЕТ 2014 год СОДЕРЖАНИЕ Обращение Председателя Совета директоров 3 Обращение Председателя Правления 4 Отчет Совета директоров о р...»

«Войтеха Мария Александровна Активность пищеварительных ферментов, гуморальный иммунитет и продуктивность свиней на низкопротеиновых рационах с различными уровнями аминокислот и энергии 03.03.01 Физиология Автореферат диссертации на соискание учёной степени кандидата биологических наук Боровск 2010 Д...»

«Внимание: конспект не проверялся преподавателями — всегда используйте рекомендуемую литературу при подготовке к экзамену! Планарии как модельный объект в биологии 1. Пресноводные планарии как модельный объект в биологии Плоские черви (пресноводные планарии) – лабораторный объект в биологии, на котором, в основном...»

«1 ФЕДЕРАЛЬНОЕ АГЕНТСТВО ПО ОБРАЗОВАНИЮ Государственное образовательное учреждение высшего профессионального образования «Уральский государственный университет им. А.М. Горького» ИОНЦ «Экология и природопользование» Хими...»

«337 Вестник ТГАСУ № 2, 2013 ВОДОСНАБЖЕНИЕ, КАНАЛИЗАЦИЯ, СТРОИТЕЛЬНЫЕ СИСТЕМЫ ОХРАНЫ ВОДНЫХ РЕСУРСОВ УДК 6.28.112.2(571.1)+556.11.003 ПОПОВ ВИКТОР КОНСТАНТИНОВИЧ, докт. геол.-мин. наук, профессор, pvk@tpu.ru СЕРЯКОВ С...»

«ДЖОЗЕФ КОРНЕЛЛ ДАВАЙТЕ НАСЛАЖДАТЬСЯ ПРИРОДОЙ ВМЕСТЕ С ДЕТЬМИ ББК 74.200.50 К 66 Перевод с англ. Владивосток: ИСАР – Дальний Восток 1999, Пер. с англ.: Е. Ламановой, Е.Кочетковой (Центр экологического образования г. Обнинск) ОТ ИЗДАТЕЛЯ Доро...»

«Муниципальное Бюджетное Общеобразовательное Учреждение Лицей №1 п. Нахабино ТЕРАТОГЕННЫЕ ФАКТОРЫ Авторы работы: Горбатюк Наталья и Князева Ольга, ученицы 11 класса e-mail: tusechka.t@gmail.com Научный руководитель: Лукуткина Ольга Анатольевна,...»

«ВОЛГОГРАДСКИЙ ГОСУДАРСТВЕННЫЙ МЕДИЦИНСКИЙ УНИВЕРСИТЕТ КАФЕДРА НОРМАЛЬНОЙ ФИЗИОЛОГИИ РУКОВОДСТВО к практическим занятиям по нормальной физиологии для студентов 2 курса лечебного, педиатрического, медико-биологического и стоматологического факу...»

«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РФ Федеральное государственное бюджетное образовательное учреждение высшего профессионального образования «КУБАНСКИЙ ГОСУДАРСТВЕННЫЙ АГРАРНЫЙ УНИВЕРСИТЕТ» ФАКУЛЬТЕТ ПЛОДООВОЩЕВОДСТВА И ВИНОГРАДАРСТВА Рабочая программа дисциплины Биоэкология и...»

«Journal of Siberian Federal University. Biology 1 (2010 3) 40-56 ~~~ УДК 574.5(28):574.58 Перифитон как экотопическая группировка гидробионтов А.А. Протасов* Институт гидробиологии НАН Украины Украина 04120, г. Киев пр. Героев Сталинграда, 12 1 Received 4.03.2010, received in revised form 11.03.2010, accepted 18.03.2010 Рас...»

«Анализ результатов диагностической работы по биологии 30 сентября 2014 года для учащихся 10 класса, химико-биологической группы, многопрофильного класса проводилась диагностическая работа по биологии. В работе принимали участие 15 учеников 10 -го класса. Назначе...»

«Пояснительная записка Рабочая программа по биологии 8 класса составлена в соответствии с федеральным компонентом государственного стандарта общего образования, одобренный совместным решением коллегии Минобразования России и Президиума РАО от 23.12.2003 г...»

«ФИЛОСОФИЯ ПСИХОЛОГО-ДИДАКТИЧЕСКИХ КОНЦЕПЦИЙ ОБУЧЕНИЯ В ИНФОРМАЦИОННОМ ОБЩЕСТВЕ УДК 37.01:374.1:004.85 ФИЛОСОФИЯ ПСИХОЛОГО-ДИДАКТИЧЕСКИХ КОНЦЕПЦИЙ ОБУЧЕНИЯ В ИНФОРМАЦИОННОМ ОБЩЕСТВЕ Воронкин Алексей Сергеевич, старший преподаватель, магистр (специальность «Научные, аналитические и экологические приборы и с...»

«Экспериментальная биология ПОЯСНИТЕЛЬНАЯ ЗАПИСКА Содержание элективного курса предусматривает практико-ориентированную деятельность учащихся по изучению биологических объектов и процессов. Это позволит “изнутри” рассмотреть важнейшие явления природы, прио...»

««FLOWER.RU» /Добро пожаловать в страну цветов Библионочь-2013 в библиотеке-филиале № 3 им. С.М. Кирова 19 – 20 апреля 19 апреля в библиотеке им. С.М. Кирова второй раз прошла акция библионочь-2013. Программа была подготовлена и проведена сотрудниками библиотек Пролетарского района г....»

«Глава 12 ЗОНАЛЬНЫЕ ТИПЫ ЭКОЛОГИЧЕСКОЙ ДЕСТАБИЛИЗАЦИИ ЛАНДШАФТОВ РОССИИ На разнообразии ландшафтов России лежит печать географической зональности. Основоположник отечественной географии В. В. Докучаев отмечал, что “человек зонален во всех проявлениях своей жизни: обычаях, религии, (особенно в нехристианских рел...»

«Бакалавриат (программа академического бакалавриата) 1 Цель и задачи освоения дисциплины Целью освоения дисциплины «Почвенная микробиология» является формирование комплекса знаний об организационных, научных и методических основах морфологии, физиологии, систематики и экологии микроорганизмов, а также влиянии абио...»

«ПРОГРАММА ООН ПО ОКРУЖАЮЩЕЙ СРЕДЕ НАЦИОНАЛЬНАЯ АКАДЕМИЯ НАУК БЕЛАРУСИ Институт генетики и цитологии БИОТЕХНОЛОГИЯ. БИОБЕЗОПАСНОСТЬ. БИОЭТИКА Под редакцией доктора биологических наук А.П. Ермишина Минск «Тэхналогiя» Электронная версия с изменениями и дополнениями от 20-12-20...»

«МИНИСТЕРСТВО ОБРАЗОВАНИЯ И НАУКИ РОССИЙСКОЙ ФЕДЕРАЦИИ ФГБОУ ВО «СГУ имени Н.Г. Чернышевского» Рабочая программа дисциплины Биология размножения и развития Направление подготовки 06.03.01 Биология.Профили подготовки: Биох...»








 
2017 www.pdf.knigi-x.ru - «Бесплатная электронная библиотека - разные матриалы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.